Table 5

Quantitative PCR primers and conditions
Probe Set ID   Primer Sequence Annealing Temp.(C) Capturing Temp. (C) Probe Size Gene Identifier Identity%
Ssc.15995.2.S1_at GGCATCATGCTGAGTTACATC 58 82 106 KCNE1 100
AGTAAGCCTTGTCCTTCTCCTG
Ssc.10078.1.A1_at CCTGAGCTGAGAGCCTAGATATG 58 79 113 PCSK5 99
TTGAATGGCTCCTCTTCAGG
 Ssc.1509.1.S1_at GTTCCAGAACAGCTCGATCC 58 82 155 TNFRSF21 98
TGCATTGATTCCTTGTGCTC
Ssc.17846.1.A1_at ACGACACAAGCACGTGAGG 58 85 157 IRX1 100
GGCAACGAAGTCAAGGACTC
Ssc.17896.1.A1_at TCTCCTCCTTCTGCATCAGC 58 81 126 FHOD3 100
GCACATGGTCCGTTCTTCTC
Ssc.17896.2.S1_at GGCAAGTTCTCTGGCAGTTC 58 84 100 FHOD3 98
TCAGCACAGCCTTCATGTTC
Ssc.19059.1.A1_at TGCAGTAGCAGGTACAATGGAG 58 78 123 AGTR1 99
ACCTTGAGAGGAGCAACAGG
Ssc.12176.3.S1_at AGAGTTCTTGCCTTCCTTCG 58 88 142 GPRC5C 99
AGGAGCTTACGACGTCATCC

Bahls et al.

Bahls et al. BMC Genomics 2013 14:443   doi:10.1186/1471-2164-14-443

Open Data