Table 4

Details of the oligonucleotides used for the quantitative RT-PCR analysis
Gene Gene Symbol Direction Sequence (5′-3′) Product size
ATP-binding cassette, sub-family G ABCG2 F CCTTCGGCTTCCAACAACT 129
(WHITE), member 2 R CCAGACACACCACGGATAAA
B-cell translocation gene 1, anti- BTG1 F TGAAAGTAGCAAGTGACCAGAA 192
proliferative R CAAGGAGAGTTACAAACCAGACC
CD4 molecule CD4 F GGCAGAACCACAGACTCACA 133
R GACAAACAAGCCCAAAGGAA
Chemokine (C-X-C motif) ligand 2 CXCL2 F GCCAAACCGAAGTCATAGCC 213
R TGGAAACCAGCCATTCTCTTC
Chemokine (C-X-C motif) ligand 12 CXCL12 F TTGAAAGCCTGACCCATAAA 146
R GACAGTGGCAGCAGAGAAG
FK506 binding protein 5 FKBP5 F CCACAGCAGCATCACACAC 189
R GGGAAGGCTAATCCAGAACC
Frequently rearranged in advanced T- FRAT1 F GCCCAAAGGACAAGGATG 186
cell lymphomas R CCAAGAACAAGCACCTCAAA
Isocitrate dehydrogenase 1 (NADP+), IDH1 F CTCTCAAGGGTAAAGGCAAA 113
soluble R TTCACAAAGGTGGCATAACTG
Lactotransferrin LTF F CTGTGGCTAAATTCTTCTCTGC 187
R TTAACAAAAGCCACGTCTCCAG
Lipocalin 2 LCN2 F CCAACTACGAGCTGAAGGAAGAC 103
R TGGGAGCTTGGGACAAAAGT
Lipopolysaccharide binding protein LBP F AGGGCAAGGTGAAAGACAGG 178
R TGGAGTCAGAGAGGGTGTGG
Mannosyl (alpha-1,3-)-glycoprotein beta- MGAT1 F TCTCCATCCAGTCCTTTCCA 191
1,2-N-acetylglucosaminyltransferase R ACATTGCTCTCCAACCCATC
S100 calcium binding protein A8 S100A8 F TCTATTTTGGGGAGACCTGGTG 203
R CCAAGTGTCCGCATCCTTTT
S100 calcium binding protein A12 S100A12 F AGGGAATCATCAACATCTTCCAC 172
R TCTTTATCGGCATCCAGGTCTT
Transforming growth factor, beta 1 TGFB1 F AATGGTGGAATACGGCAACA 121
R CCGAGAGAGCAACACAGGTTC
Xanthine dehydrogenase XDH F TCAGGATGATGGTTGGAAGA 193
R GGGAGTTAGGACATAGCACGA
Chromosome alignment maintaining CHAMP1 F AGCAGTGACCAAGAGCAGGT 205
phosphoprotein 1 R TCATAGCACGACAGCAACAA

F and R denote forward and reverse primers respectively.

Jensen et al.

Jensen et al. BMC Genomics 2013 14:36   doi:10.1186/1471-2164-14-36

Open Data