Table 3

cDNA sequences obtained from NF (fruited-leaves in November) and their homologous GenBank records
cDNA GenBank Accn No** Size (nt) GenBank record(s) with informing similarity E - Value Primer pairs used in qRT-PCR (All sequences are presented from 5’ to 3’. F: Forward, R: Reverse)
NF3 NF96 GW574256 900 Nicotiana sylvestris cryptochrome 1 (cry1) mRNA (gi78217440) F: AAACGGTTAGAACCATCAATACTTTC
R: CCAGTGAATTGATCAGAGAAATTAGA
NF17* NF90* GW574257 1780 Arabidopsis thaliana DNAJ heat shock family protein (At2g22360) mRNA (gi42569238) 1e-67 F: ATGCTGAAGAGAAGTTTAAGGAGATTAG
R: TCAAATAATGACTCAAATAGATCAAAGG
NF69* NF99* GW574258 700 Arabidopsis thaliana PSI-N; calmodulin binding (PSAN) mRNA (gi145359627) 2e-67 F: GTACCATATATTTCTGAGGACTTGGAG
R: GTTTAGAAGTTGCAAGTGGAAAAATAG
NF2* GW574259 900 Avicennia marina dehydrin (DHN) mRNA (gi157497150) 2e-28 F: ATGAAGGAACTTACGACACTTCAAC
R: TAATACAAACATGAAAAAGCACACG
NF8* GW574260 1000 Lycopersicon esculentum transcription factor JERF1 (JERF1) mRNA (gi22074045) 5e-55 F: GAGAAACCGCCAACAAATAAGTATAG
R: ATTTCTGGAGTTTTAGCACAATTTTC
NF9 GW574261 400 Avicennia marina class I type 2 metallothionein mRNA (gi12963447) 2e-41 F: GAATTGTATGAATGTTTTGGGTAAATC
R: TTGGTTTTTCGGTATATAATTAAGCAG
NF22 GW574262 1000 A gene complex of multiple tRNA genes and Photo System II binding proteins (see Accn gi170785601 at NCBI) 0.0 F: GCCTCTAGGAATTTCTGGTACTTTC
R: GTAACCTGCATTAGCAGATTCATTT
NF37* GW574255 1180 Arabidopsis thaliana EMBRYO DEFECTIVE 2734 lyase mRNA (gi30687496) 2e-85 F: CTGGTTGAGCTGCTTACCTATAAAA
R: TTGCTCTGTAGCAAGATCTTTACCT
NF41* GW574263 2000 Arabidopsis thaliana splicing factor, putative (At5g64270) mRNA (gi30697984) 0.0 F: TTATTGAACATGGTCTTAATGATGAAA
R: ATATATGGCATCCATAAGTGGTATGAT
NF58* GW574264 4000 Arabidopsis thaliana glycosyl hydrolase family 38 protein (At5g13980) mRNA (gi79598780) 1e-99 F: TTTATTAAGAAGGAGTTTGGTGTGACT
R: AACGACTTCAAGACTCTCTCATATTTC
NF60* GW574265 2000 Arabidopsis thaliana AtEXO70E2 binding protein mRNA (gi30697462) 7e-09 F: ATGAGGTAGTGAAAGAAGATGGACTTA
R: ATTATTTAGGCTCAATCTCTCCAAACT
NF95* GW574266 3000 Datura stramonium mRNA for arginine decarboxylase 1 (adc1 gene) (gi6646839) 2e-54 F: CTAATCACCCTTCCAAGATTCTTTACT
R: AGAAAGCGTGGAGTATGAGTAGTATGT

* cDNAs that are new for olive.

** Obtained from GenBank for the sequences generated through this study.

Dündar et al.

Dündar et al. BMC Genomics 2013 14:219   doi:10.1186/1471-2164-14-219

Open Data