Table 1

Nested-PCR primers
CSNK2B LY6G5B
First Round Second Round First Round Second Round
H.sapiens F HsCSNK2BE1f01 Hs-MamCSNK2BE1-2f01 HsLY6G5BE1f01 HsLY6G5BE1f02
CGTTCCCTGGAAGTAGCAA GCTGACGTGAAGATGAGCAG GAGCATGGTCACAGGAAGGT CATCTCCCCAGAATTCCAAA
R Hs-SsCSNK2BE7r02 Hs-Mam-RnCSNK2BE7r01 HsLY6G5BE3r02 Hs-MamLY6G5BE3r01
CCCACCACAATAACGACTCC TCAGCGAATCGTCTTGACTG CGGAGGCCTAAGAAATCACA TGTTTTCAGAGAGGGCAGTG
M.mulata F MamCsnk2bE1iso1f01 Hs-MamCsnk2bE1-2f01 MamLy6g5bE1f01 MamLy6g5bE1f02
ACCCTCCCCAATTTCCACT GCTGACGTGAAGATGAGCAG TCACAGGAAGGTGGGGTTT CGTCTCCCCAGAATTCCATA
R Mam-BtCsnk2bE7r02 Hs-Mam-RnCsnk2bE7r01 MamLy6g5bE3r02 Hs-MamLy6g5bE3r01
TCCCACCACAATAATGACTCC TCAGCGAATCGTCTTGACTG CAACAGAGGGAGGCCTAAGA TGTTTTCAGAGAGGGCAGTG
S.scrofa F SsCsnk2bE1f01 SsCsnk2bE1-2f01 SsLy6g5bE1f01 SsLy6g5bE1f02
TCCTTGGAAGCAGAAACTCC CGCTGAAGTGAAGATGAGCA CTCAGGGATCACCCCTCTC TCACGTGCTCGTAGGTATGC
R Hs-SsCsnk2bE7r02 SsCsnk2bE7r01 SsLy6g5bE3r02 SsLy6g5bE3r01
CCCACCACAATAACGACTCC GGGAATCAGCGAATTGTCTT GAATGCTGGGGTCTTAGGG CCGGGAAGGATGAGATGTTA
B.taurus F BtCsnk2bE1f01 BtCsnk2bE1-2f01 BtLy6g5bE1f01 BtLy6g5bE1f02
GAAGCAGAAACTCCCCTTCC CCGACGTGAAGATGAGCAG GTCAGAACCACCCTGCAGTT CTCTCCCCAGAAGTCCATGA
R Mam-BtCsnk2bE7r02 BtCsnk2bE7r01 BtLy6g5bE3r02 BtLy6g5bE3r01
TCCCACCACAATAATGACTCC GGAATCAGCGAATCGTCTTC GGGGTGTCAGGAGTGAGATG AATCTATCTGCGACGGGAAA
R.norvegicus F Rn-MumCsnk2bE1f01 Rn-MumCsnk2bE1-2f01 RnLy6g5bBE1f01 RnLy6g5bE1f02
GTTCCTTGGAAGCACAGCTC CCGCGGACATAAAGATGAGT AGTGTGATCCCAGGAAGGTG CTACTCCACGGGAGTTGCTC
R RnCsnk2bE7r02 Hs-Mam-RnCsnk2bE7r01 RnLy6g5bE3r02 RnLy6g5bE3r01
GTGTCACAGGCAGAGGAGGT TCAGCGAATCGTCTTGACTG CCATGGAGAGCAGAAGGAAG CAGAGCAGAATCTGGGAAGG
M.musculus F Rn-MumCsnk2bE1f01 Rn-MumCsnk2bE1-2f01 MumLy6g5bE1f01 MumLy6g5bE1f02
GTTCCTTGGAAGCACAGCTC CCGCGGACATAAAGATGAGT ACTGCCTGTCAAACCCATTC TCCCCCAAATTCCATAATGA
R MumCsnk2bE7r02 MumCsnk2bE7r01 MumLy6g5bE3r02 MumLy6g5bE3r01
AGCAGAGGAATGGTGGTGTC GTGGGCAATCAGCGAATAGT GAGTGTTCACAGACCGCAGA GGGGAACACATCAGGGTCTA

Name and sequence (5’-3’ orientation). F, forward primer; R, reverse primer.

Hernández-Torres et al.

Hernández-Torres et al. BMC Genomics 2013 14:199   doi:10.1186/1471-2164-14-199

Open Data