Table 2

Primers for real-time quantitative PCR
Gene Accession number 5-3sequence Amplicon size
IGF1 NM_001077828 Fw: AGTTGGTGGATGCTCTCCAGT 115
Rw: CACTCATCCACGATTCCTGTC
IGF1R NM_001244612 Fw: GGACGCAGTACGCCGTTTAC 187
Rw: AGGGAGGGCGGGTTCCACTT
PPP3CA NM_174787 Fw: CAAGGCAATTGATCCCAAGT 204
Rw: AGAATTGAAGCCCCCTCTGT
NFATc1 NM_001166615 Fw: TACGAGCTGAGGATCGAGGT 139
Rw: GAGGCTCGCTCTCCACATAG
MEF2C NM_001046113 Fw: CAGTCATTGGCTACCCCAGT 151
Rw: GCGGTGTTAAAGCCAGAGAG
GSK3b NM_001101310 Fw: TTCCTTTGGAATCTGCCATC 233
Rw: ACAGCTCAGCCAACACACAG
TEAD1 XM_002693050 Fw: CTCAGGACAGGGAAGACGAG 134
Rw: GGCTGCCCTGTTTGTATCAT
MSTN NM_001001525 Fw: GTGTTGCAGAACTGGCTCAA 256
Rw: CAGCATCGAGATTCTGTGGA

Primer sequences used for real-time quantitative PCR were designed on Bos taurus GenBank mRNA sequences using Primer 3 Software (version 4.0). Table summarizes primer information including sequences, gene accession number and amplicon sizes.

Miretti et al.

Miretti et al. BMC Genomics 2013 14:194   doi:10.1186/1471-2164-14-194

Open Data