Table 2

A set of 11 multiplex panels including the 30 most informative ruzigrass microsatellite markers
Panel Marker Dye Forward Primer Reverse Primer Allele No Observed size ranges He Ho PIC
1 Brz0182 NED ACGTTATTGGACTTGGGTGA AGCCTGACCAAATTCTTGTG 10 252-328 0.823 0.545 0.868
Brz0097 HEX TAATTTGTTCCACCCACAGG GTGACAGAGTTCGGGAGCTA 5 234-242 0.705 0.375 0.747
2 Brz0075 6-FAM GAAGCTGCAAAGGCTGAGT GGAGGAGAGAGAAGAGCAAGA 8 129-153 0.809 0.727 0.839
Brz0148 6-FAM GCTCTTGACCTTGACGATGT TGCACTTGAGAGAGACGAAA 8 248-274 0.787 0.909 0.800
Brz0083 HEX CATGATATTTGCCTGTCAAGG AGCACCGGTGATGTGAATA 6 233-249 0.765 0.778 0.788
3 Brz0017 HEX TTCCATTTATTTGCCTGTTCA ATTTTCCCTATCCGACCTTTC 11 134-160 0.840 1000 0.864
Brz0116 HEX TCAAGAAATGGACTCCCAAA TCTAGGTCATGCAAGCCATT 9 223-271 0.803 0.900 0.827
Brz0047 6-FAM TGTGAGACATAAACCATTGGAA AATGGGTGCTGGAAATGTAAC 7 150-170 0.731 0.556 0.762
4 Brz0021 HEX CAGCTGAAAGTTCCCAAAAAT CTGAATGATAAAGGGTGCAAA 9 151-183 0.770 0.400 0.816
Brz0087 NED TTCCCCCACTACTCATCTCA AACAGCACACCGTAGCAAGT 6 239-273 0.716 1000 0.748
5 Brz0065 6-FAM AGCTAAGCAAATTTCAAGAACG TAATGTGGAACATTGCCCTAA 12 130-166 0.829 0.700 0.875
Brz0130 6-FAM TCCTTTCATGAACCCCTGTA CATCGCACGCTTATATGACA 9 242-266 0.820 0.636 0.858
Brz0131 HEX TGCAATGACATTAAATCAACC GCTGCAACACAAACAAAATAA 6 254-264 0.712 0.714 0.744
6 Brz0147 HEX CTGAGGACGCTCCTACTGAA TTGATTTCAACACCCCAACT 10 240-288 0.825 0.700 0.868
Brz0031 6-FAM CCCCCATTTAACACCATAGTT GCTCAAAATGCAATGTACGTG 7 144-156 0.770 0.667 0.804
7 Brz0177 6-FAM TGGAGTTGAGGCTTTAGGAA GTGTTTGGAAACCACTTGCT 6 291-319 0.725 0.125 0.795
Brz0107 6-FAM AGAGGAATTGACTTGGAAAAA GCATGCACGTAAATTTTCACT 6 227-247 0.747 0.444 0.788
Brz0004 6-FAM TTGTTGTGGTACACCGGTACT CAAAACCTGAATCACCATGTC 6 113-155 0.703 0.222 0.745
8 Brz0118 NED AGGAGGTCCAAATCACCAAT CGTCAGCAATTCGTACCAC 10 237-263 0.812 0.636 0.849
Brz0219 HEX GCAGTTCTTGCTTTTTCAGG TCTCCTTATGCAAGGCTTC 6 294-304 0.768 0.818 0.778
Brz0156 6-FAM GCCATGATGTTTCATTGGTT TTTTGCACCTTTCATTGCTT 7 239-265 0.752 0.636 0.770
9 Brz0142 6-FAM GCTGGGTTATGCTAATGCAA TCAAGCATGAACATTGAAACA 10 241-287 0.823 0.875 0.871
Brz0180 HEX CACACGGTCCATCTTGATTT TCCATAATGCATTGTCTTGAAA 7 285-305 0.751 0.091 0.800
Brz0089 NED CAAACCTATTCCACGGTCAA TGGACAATGCTATTCAAACG 7 224-248 0.710 0.571 0.759
10 Brz0048 HEX GAATCTAAGCAGCGGATCAAT TCACAAGAAGGTCCTCACAAG 9 139-161 0.813 0.818 0.839
Brz0206 NED GAAGTGGCAAGACACACACA TGAGCTTTTCGTCTCTCCTG 7 278-302 0.757 0.600 0.783
Brz0038 6-FAM CTGAAAATAAGAGCCGTCCAT ATAAGGTGAGCCACAACTGAG 6 140-154 0.772 0.909 0.778
11 Brz0171 6-FAM TTGTCTCACTTGTGCACTCC GCTAGCAGGTAGCAAGATGG 7 312-348 0.725 0.250 0.787
Brz0015 6-FAM AATAGAAAACGTGAGCCCATT TCCACCAATATGATTCAAACG 6 144-156 0.764 0.636 0.783
Brz0152 NED ATGCTGCACTTACTGGTTCA GGCTATCAATTCGAAGACCA 6 228-248 0.748 0.667 0.774

Silva et al.

Silva et al. BMC Genomics 2013 14:17   doi:10.1186/1471-2164-14-17

Open Data