Table 6

The PCR primers used in this study
Primer Primer sequencea (5to3) Restriction site
pSVH01F GCCCCC
    CATATG
AGTGAGTCCCTCCACACCGTC
NdeI
pSVH01R GGAG
    GAATTC
ACTTCGCGTCCCAGGTG
EcoRI
pSVF09F CCG
    GAATTC
GGGACGCGAAGTGAGCGCGG
EcoRI
pSVF09R CCC
    AAGCT
TTCAGGCGGAGGGTGGGCGG
Hind III
pSVU022F CT
    GGATCC
ATGAGCTGCCCGATCGACC
BamHI
pSVU022R CCT
    AAGCTT
TCAGGGGTGCAGGCGTACCG
SmaI

aThe underlined sequence are recognition sites of restriction enzymes and the nucleotides before it are the protected bases. All primers are designed by Primer Premier 5.0 and verified by Oligo 7.0.

Li et al.

Li et al. BMC Genomics 2013 14:130   doi:10.1186/1471-2164-14-130

Open Data