Table 2

Conserved miRNAs from common bean

miRNA

family

Reference

miRNA

Sequence (5'- 3')

Length (nt)

Reads


LL

FL

RL

SL

Total


156

ahy-miR156a

UGACAGAAGAGAGAGAGCAC

20

56

15

8

41

120


ahy-miR156c

UUGACAGAAGAGAGAGAGCAC

21

94

3512

3

317

3926


ath-miR156a

UGACAGAAGAGAGUGAGCAC

20

82529

63

3705

14478

100775


ath-miR156g

CGACAGAAGAGAGUGAGCAC

20

74

0

3

10

87


bna-miR156a

UGACAGAAGAGAGUGAGCACA

21

112

21

2

26

161


ptc-miR156k

UGACAGAAGAGAGGGAGCAC

20

47

0

6

2

55


vvi-miR156e

UGACAGAGGAGAGUGAGCAC

20

30

0

1

1

32


zma-miR156k

UGACAGAAGAGAGCGAGCAC

20

183

0

14

10

207


157

ath-miR157a

UUGACAGAAGAUAGAGAGCAC

21

3114

2787

4370

4839

15110


ath-miR157d

UGACAGAAGAUAGAGAGCAC

20

361

30

26

89

506


159

aqc-miR159

UUUGGACUGAAGGGAGCUCUA

21

33

312

43

89

477


pvu-miR159a.1

UUUGGAUUGAAGGGAGCUCUA

21

67007

1082688

180739

453692

1784126


ath-miR159b

UUUGGAUUGAAGGGAGCUCUU

21

3

438

135

178

754


gma-miR159c

AUUGGAGUGAAGGGAGCUCCG

21

0

0

1044

25

1069


gma-miR159d

AGCUGCUUAGCUAUGGAUCCC

21

78

148

202

240

668


osa-miR159a.1

UUUGGAUUGAAGGGAGCUCUG

21

37

224

31

148

440


osa-miR159f

CUUGGAUUGAAGGGAGCUCUA

21

57

666

298

182

1203


pta-miR159a

UUGGAUUGAAGGGAGCUCCA

20

0

3

0

25

28


160

ath-miR160a

UGCCUGGCUCCCUGUAUGCCA

21

136

5160

5474

104

10874


bdi-miR160

UGCCUGGCUCCCUGUAUGCC

20

9

212

225

5

451


osa-miR160f

UGCCUGGCUCCCUGAAUGCCA

21

9

3

240

2

254


162

ath-miR162a

UCGAUAAACCUCUGCAUCCAG

21

597

583

517

1192

2889


zma-miR162

UCGAUAAACCUCUGCAUCCA

20

14

22

15

30

81


164

ath-miR164a

UGGAGAAGCAGGGCACGUGCA

21

7245

5621

3628

1229

17723


ath-miR164c

UGGAGAAGCAGGGCACGUGCG

21

49

71

91

122

333


166

gma-miR166a

UCGGACCAGGCUUCAUUCCCC

21

5333

53276

20481

15163

94253


ctr-miR166

UCGGACCAGGCUUCAUUCCCCC

22

2

18

10

10

40


osa-miR166e

UCGAACCAGGCUUCAUUCCCC

21

0

17

8

4

29


vvi-miR166a

UCGGACCAGGCUUCAUUCC

19

93

205

166

382

846


zma-miR166h

UCGGACCAGGCUUCAUUCCC

20

140

769

352

630

1891


167

ath-miR167a

UGAAGCUGCCAGCAUGAUCUA

21

661

2883

3251

90

6885


ath-miR167d

UGAAGCUGCCAGCAUGAUCUGG

22

22003

1443

5196

626

29268


bna-miR167a

UGAAGCUGCCAGCAUGAUCUAA

22

2

0

17

0

19


ccl-miR167a

UGAAGCUGCCAGCAUGAUCUGA

22

2267

8164

2727

276

13434


osa-miR167d

UGAAGCUGCCAGCAUGAUCUG

21

15021

20039

6209

378

41647


ptc-miR167f

UGAAGCUGCCAGCAUGAUCUU

21

36

252

146

5

439


168

ath-miR168a

UCGCUUGGUGCAGGUCGGGAA

21

382

991

605

43

2021


169

ath-miR169a

CAGCCAAGGAUGACUUGCCGA

21

0

11

0

44

55


ath-miR169b

CAGCCAAGGAUGACUUGCCGG

21

1339

8784

154

6351

16628


gma-miR169d

UGAGCCAAGGAUGACUUGCCGGU

23

0

4

11

0

15


gma-miR169e

AGCCAAGGAUGACUUGCCGG

20

133

47

62

316

558


mtr-miR169c

CAGCCAAGGGUGAUUUGCCGG

21

3916

166

78

2

4162


mtr-miR169d

AAGCCAAGGAUGACUUGCCGG

21

126

863

389

4

1382


osa-miR169e

UAGCCAAGGAUGACUUGCCGG

21

1

29

1

16

47


171

ath-miR171b

UUGAGCCGUGCCAAUAUCACG

21

119

790

0

37

946


sly-miR171d

UUGAGCCGCGCCAAUAUCAC

20

2

1

67

7

77


zma-miR171b

UUGAGCCGUGCCAAUAUCAC

20

28

40

13

2

83


zma-miR171f

UUGAGCCGUGCCAAUAUCACA

21

62

245

139

68

514


172

ath-miR172a

AGAAUCUUGAUGAUGCUGCAU

21

43

38

24

1

106


ptc-miR172g

GGAAUCUUGAUGAUGCUGCAG

21

353

18985

200

51

19589


sbi-miR172b

GGAAUCUUGAUGAUGCUGCA

20

1

193

7

0

201


zma-miR172a

AGAAUCUUGAUGAUGCUGCA

20

344

565

622

36

1567


319

ath-miR319a

UUGGACUGAAGGGAGCUCCCU

21

0

1672

192

320

2184


mtr-miR319

UUGGACUGAAGGGAGCUCCC

20

21

66392

4936

40730

112079


osa-miR319a

UUGGACUGAAGGGUGCUCCC

20

0

19

5

3

27


ppt-miR319a

CUUGGACUGAAGGGAGCUCC

20

1

1622

14

106

1743


ppt-miR319c

CUUGGACUGAAGGGAGCUCCC

21

16

11934

643

3082

15675


pta-miR319

UUGGACUGAAGGGAGCUCC

19

0

1917

201

1139

3257


ptc-miR319e

UUGGACUGAAGGGAGCUCCU

20

0

22

58

45

125


vvi-miR319e

UUUGGACUGAAGGGAGCUCCU

21

0

55

2

1

58


vvi-miR319g

UUGGACUGAAGGGAGCUCCCA

21

0

285

23

53

361


390

ath-miR390a

AAGCUCAGGAGGGAUAGCGCC

21

299

1264

153

63

1779


gma-miR390b

AAGCUCAGGAGGGAUAGCACC

21

46

25

193

124

388


393

ath-miR393a

UCCAAAGGGAUCGCAUUGAUCC

22

51

295

441

9

796


osa-miR393

UCCAAAGGGAUCGCAUUGAUC

21

13

65

101

0

179


394

ath-miR394a

UUGGCAUUCUGUCCACCUCC

20

71

7473

339

482

8365


vvi-miR394a

UUGGCAUUCUGUCCACCUCCAU

22

0

112

7

0

119


395

tae-miR395b

UGAAGUGUUUGGGGGAACUC

20

5

25

4

8

42


396

ath-miR396a

UUCCACAGCUUUCUUGAACUG

21

760

44655

10489

601

56505


ath-miR396b

UUCCACAGCUUUCUUGAACUU

21

1

185

33

16

235


gma-miR396d

AAGAAAGCUGUGGGAGAAUAUGGC

24

0

61

22

77

160


gma-miR396e

UUCCACAGCUUUCUUGAACUGU

22

0

29

6

0

35


ptc-miR396f

UUCCACGGCUUUCUUGAACUG

21

0

11

4

1

16


vvi-miR396a

UUCCACAGCUUUCUUGAACUA

21

0

23

2

1

26


vvi-miR396b

UUCCACAGCUUUCUUGAACU

20

742

19924

2108

823

23597


397

ath-miR397a

UCAUUGAGUGCAGCGUUGAUG

21

2057

13

5276

70

7416


zma-miR397a

UCAUUGAGCGCAGCGUUGAUG

21

5

0

23

0

28


398

ahy-miR398

UGUGUUCUCAGGUCACCCCU

20

0

25

350

0

375


osa-miR398b

UGUGUUCUCAGGUCGCCCCUG

21

3760

57

1717

7

5541


399

ath-miR399a

UGCCAAAGGAGAUUUGCCCUG

21

15

12

4

0

31


ath-miR399b

UGCCAAAGGAGAGUUGCCCUG

21

35

121

22

2

180


osa-miR399e

UGCCAAAGGAGAUUUGCCCAG

21

49

45

3

1

98


408

ath-miR408

AUGCACUGCCUCUUCCCUGGC

21

2083

3718

9050

167

15018


bdi-miR408

AUGCACUGCCUCUUCCCUGG

20

5

25

67

0

97


osa-miR408

CUGCACUGCCUCUUCCCUGGC

21

3

5

17

0

25


ppt-miR408b

UGCACUGCCUCUUCCCUGGCU

21

0

5

55

0

60


482

gso-miR482a

UCUUCCCUACACCUCCCAUAC

21

7

318

85

2

412


pvu-miR482

UCUUCCCAAUUCCGCCCAUUCC

22

5

291

54

0

350


1511

gma-miR1511

AACCAGGCUCUGAUACCAUG

20

978

625

449

1529

3581


1514

pvu-miR1514a

UUCAUUUUGAAAAUAGGCAUUG

22

188

5481

1282

311

7262


1515

gma-miR1515

UCAUUUUGCGUGCAAUGAUCUG

22

27

853

341

86

1307


2111

ath-miR2111a

UAAUCUGCAUCCUGAGGUUUA

21

48

211

255

0

514


2118

mtr-miR2118

UUACCGAUUCCACCCAUUCCUA

22

8

7

1

1

17


pvu-miR2118

UUGCCGAUUCCACCCAUUCCUA

22

238

17300

13707

1771

33016


2119

gma-miR2119

UCAAAGGGAGUUGUAGGGGAA

21

85

42

1448

6

1581


Conserved miRNAs in common bean identified in leaves (LL), roots (RL), seedlings (SL) and flowers (FL).

Peláez et al. BMC Genomics 2012 13:83   doi:10.1186/1471-2164-13-83

Open Data