Table 1

Primers used in the first round of emulsion haplotype fusion PCR
Primer name Primer sequence (5’-3’)
Centromeric Emulsion PCR F1 AATGCACGCTGGTATTCTGCAA
F2’R1 TTCTCTAGCCCATCCTTGCAGGCGGGAGAGAGGTTCCAGAGTTG
R2 TGGTGTTGGCTCAGCTGGAA
Telomeric Emulsion PCR system 1 F1 TTCATTGGCCACCCTGGACT
F2’R1 TTGCAGAATACCAGCGTGCATTCCCCCTGGAAACCTCAATCC
R2 CGGGAGAGAGGTTCCAGAGTTG
Telomeric Emulsion PCR system 2 F1 TGCCTCAGTCTTCCCCAAAG
F2’R1 TTGCAGAATACCAGCCTGCATTTTACCAGACGCCACCAGTCA
R2 CGGGAGAGAGGTTCCAGAGTTG

Tyson and Armour

Tyson and Armour BMC Genomics 2012 13:693   doi:10.1186/1471-2164-13-693

Open Data