Table 4

List of primers used for AFLP analysis
Marker Sequence of selective primers (5→3)
Mse I Eco RI
Pre-selective GATGAGTCCTGAGTAAC GACTGCGTACCAATTCA
M01E1 GATGAGTCCTGAGTAACACA NED-GACTGCGTACCAATTCAAC
M01E8 GATGAGTCCTGAGTAACACA JOE-GACTGCGTACCAATTCAGG
M02E1 GATGAGTCCTGAGTAACACT NED-GACTGCGTACCAATTCAAC
M02E3 GATGAGTCCTGAGTAACACT FAM-GACTGCGTACCAATTCACA
M03E1 GATGAGTCCTGAGTAACACC NED-GACTGCGTACCAATTCAAC
M03E2 GATGAGTCCTGAGTAACACC JOE-GACTGCGTACCAATTCAAG
M05E8 GATGAGTCCTGAGTAACATA JOE-GACTGCGTACCAATTCAGG
M06E1 GATGAGTCCTGAGTAACATT NED-GACTGCGTACCAATTCAAC
M07E2 GATGAGTCCTGAGTAACATC JOE-GACTGCGTACCAATTCAAG
M08E1 GATGAGTCCTGAGTAACATG NED-GACTGCGTACCAATTCAAC
M08E3 GATGAGTCCTGAGTAACATG FAM-GACTGCGTACCAATTCACA
M13E3 GATGAGTCCTGAGTAACTTA FAM-GACTGCGTACCAATTCACA
M23E3 GATGAGTCCTGAGTAACTAC FAM-GACTGCGTACCAATTCACA
M24E3 GATGAGTCCTGAGTAACTAG FAM-GACTGCGTACCAATTCACA

Nakatsuka et al.

Nakatsuka et al. BMC Genomics 2012 13:672   doi:10.1186/1471-2164-13-672

Open Data