Table 1

List of primers used for SSR analysis
Markers Repeat motif Sequence (5→3) Product size (bp) Amplification Accession no.
Forward Reverse
AC1 (AC)11.(AC)3.(TA)4 TATCAGCAAGATGGTGCATGGTTT CCGAAAACAGGTAAAGTGTCCATGA 160 G. scabra AB755678
AC2 (AT)3.(AC)11 AGTGGGCTGGTTGGGTTTAGATTC TACTTCAGAAGGCTGGGGTCTACG 250 G. triflora / G. scabra AB755679
AC62 (AC)6.(CA)8.(CA)7 TAGTTTCTTTGGTGTGGGACCTGG GGAGGAGCGTTGCTATGTTGAAGT 129 G. triflora / G. scabra AB755680
CA10 (CA)12(TA)3 CTGGAAAACACCCAACACACACAT ATCCATGTCCTCTCCGTGTAGCTC 187 G. triflora / G. scabra AB755681
CA28 (CA)9 GCAAAATCTTTTTATTTCTTGTGTGCG CAGCACTGTGCAAGTCATATCTTGTG 134 G. triflora / G. scabra AB755682
CA36 (CA)3.(CA)8 GTGGGGAAAACAAATAGCTCTTGAGG TCGATCATTACCTGTTGTTTCAAGAT 131 G. triflora / G. scabra AB755683
CA43 (CA)4(AC)7 ATTTCCTGAAACAATGAAGTCTTATG CGTGAAACAAAGGGATCAAAAGTATC 200 G. triflora / G. scabra AB755684
CD3 (GGA)5.(GA)3 GGATCAAAAGCGATGGATCTGTTC ATGAAGCTCCTCACCTTGTCAACC 156 G. scabra AB755685
CD12 (AGT)3.(AGT)7 CCCCACCACATGGACCATAATAAC ATATGGAGCGGGAGGTGAAGTTTT 183 G. triflora / G. scabra AB755686
CD26 (AG)3.(TAA)7(CAA)2 TCTCACAAGCAATGCAAGACCAAT TGGTGTACTTAGCCCTTTCGTCGT 207 G. triflora / G. scabra AB755687
CD35 (GCG)5.(CAG)3 TAGGGACGTACCCGACTCAAGAAA GAGAGAAGTAGGAGGAAGAGCCGC 225 G. scabra AB755688
CD41 (ACA)6 TCAACGTCCAGTCCGATAATGAGA GAACCGCACAGTAAACGCCTAATC 240 G. triflora / G. scabra AB755689
CD43 (AT)3.(AC)7(TA)6 TGTGCATCACTTTACTGCTTTCTCTTG CCCAAGAATCAACTTGGCTTGAAC 244 G. triflora / G. scabra AB755690
CD44 (AT)10 TACTTGGCGGAGAGGCTTATGAAA ACACCACAAAAGGACAGTCGTTGA 244 G. triflora / G. scabra AB755691
HC5 (CA)10 GCTTTAGCAACTCCCTCAATCCCT GGGAAGTGAGTAATGTTCAGGTGTC 115 G. triflora / G. scabra AB755692
HC6 (CA)14(TA)3.(TA)3 TCCTAACATCGGTGCGAGAATGTA AGTTTGTTTCAGAACTTGGGGCAG 115 G. scabra AB755693
HC7 (CA)10 ACGCTGAACCTGTGAGATTTCTTG AACTCCCATGGACCAGACACATTT 119 G. triflora / G. scabra AB755694
HC18 (AC)5.(AC)4 CAAAGCAGCAGCAAATATAGGGAA GCTCAGCAATTGTCATTCCTGCTA 156 G. scabra AB755695
HC20 (CA)3.(TG)6 TCTCGGTTGAATAGAACTCACCCC TCGTAGACCTAGCACTTTCACGCA 158 G. scabra AB755696
HC23 (GA)14 TAGAAGTGTGTGCAATTTGGGCAT AAAAGCAGATAAAGGAAGAGGGGG 164 G. triflora / G. scabra AB755697
HC26 (CA)9 AGCTTGACGTTGTCTGAGGGTTTC GCAAAAGTTTAATCGTAAGCAGGCA 176 G. triflora / G. scabra AB755698
HC29 (CA)5.(AC)3.(CA)7(TA)3 CACACGCTAACAAGCACACAGCTA TTCCTGCTTTTGTCATCCAAAGGT 194 G. triflora / G. scabra AB755699
HC41 (CA)10.(ACA)6 CGTTTCTTGAGCTTATTTTTGGCG CATTTCAGATTTCTGCCACCCTTC 219 G. triflora / G. scabra AB755700
HC48 (TA)3T(TA)4G(AT)3.(CA)7 GTGTATGGCTCGAATTGTGGACTG AAGTGGGTCTTGGGGTGAAATACC 227 G. scabra AB755701
HC49 (CA)9 CTTTTCCCATGCATAGAATCTCCG GCTATGGCTGGCTAGTTTCCTTTC 229 G. scabra AB755702
HC71 (CA)3CT(CA)11 TGAAGTCACAAACTGCGTGTTGAA GTGGAACCTTTGTCTTCTTCCCCT 253 G. triflora / G. scabra AB755703
HC72 (CA)10 AGGAATCATTTGAAGGGGTTGGTT CCGGTAATTCCCTTGAGGCATAAT 256 G. scabra AB755704
HC90 (CT)3.(AC)3(CA)12(TA)8 GGTAATGCTTATGCAAGTTTGAAGG TATTCTCCGTGTGTCCAGCTATGG 285 G. triflora / G. scabra AB755705
HC91 (CA)7.(CA)6.(CA)6.(CA)9.(CT)6.(CT)3 GCATTATTTTTCTGGAGCTAGGGGA GGGCAGCCCTGGATAATACCTCTA 286 G. triflora / G. scabra AB755706
HC100 (TA)5.(CA)8.(GA)3 GCCGTTTTTCCTGTCCTAAGGAGT GGGCTTGGCGAGGTAGAACTAAAA 294 G. scabra AB755707
HC103 (AG)18 ATTTCCTCCTGCTACATGAACCCA GCTGAGAAAGAAGCCAACTCCAAA 299 G. triflora / G. scabra AB755708
HG13 (CA)12 CAGTTCCACTGAAATTCCGCAGAT TATTCGTTGAAAATGGCACCCTTC 102 G. scabra AB755709
HG16 (TC)3.(CA)15(TA)3 CCATCAAATACCCATTACCACAGAA TCTTATCTGAACGGGAAGCCCATA 259 G. triflora / G. scabra AB755710
HG26 (AC)20(AT)11 GCAATTTCTTGAACCCGTAAACCA TGTGGAAACACGTGATGCTGAATA 149 G. scabra AB755711
HG42 (CA)15 GCATCATATCCCAAGGTCCATCTC GCGTAGATACCATCTCCGGTCAAC 236 G. triflora / G. scabra AB755712
RC13 (CA)14(TA)9.(AC)4.(TA)7 ACGGATACGGGAGTGTATTTGTAA TTTATTTTAATCTTGCCCCGGACC 185 G. scabra AB755713
RC25 (CA)11 ACCAAATAGGTGTATCCGTCCGTG TCAATCCAGGTAAATGAGACTGCTTTC 142 G. scabra AB755714
ReSN7 (TA)3.(CA)16(TA)4C(TA)4 CACTGCCGGTAAGATTGGATACCT TATAAGGACTCAGTGTCGGGACGG 173 G. triflora / G. scabra AB755715
ReSN22 (CA)13(TA)4.(CA)4 TGTCAGTCGGGTAAGCACTTTCAG ATCAAAGCACTTGTCTGTCCTCCC 146 G. triflora / G. scabra AB755716
ReSN84 (AC)11 TGTAAAGGGCAAAGGAGGAAAACA AGCTGTAAGTTGAAAACGCCTTGA 110 G. triflora / G. scabra AB755717
SA3 (CA)12 GTACCTCTGCACATTTGTTTGGTA GCTCTTTTCTAGCCGTTTTATGTC 182 G. triflora / G. scabra AB755718
SA4 (GA)8 CTTCTTCTCATTCCAGTTTCACCT AGCACCTAGATTACACGTACACCA 254 G. triflora / G. scabra AB755718
SA12 (CA)10 GTAGGACTCTGCACAAGAAGTAGGT ACAATAAATATGGAGGCTGTAGGC 224 G. triflora / G. scabra AB755719
SH9 (AG)15 CTAATGTAGGACTGAATGACCCG GCAAGAAGTAAAACGTAAAGCCTG 200 G. triflora / G. scabra AB755720
SH14 (AG)13 AGCACATTTCCCGCTACAAC TCTTCAGGAGGAGGAGTTTGAGT 247 G. triflora / G. scabra AB755721
SN7 (CA)8 AAGAAACTTGGGATGTTTCAGC AAGCTGCATTTGTTGAAGATCA 197 G. triflora / G. scabra AB755722
SN24 (CA)11 TGGCTTGTTTTGTATTGGAGTG GTTCATTCCCCGGATAAGAAAT 157 G. triflora / G. scabra AB755723
SN27 (AC)11 CATGGTGAGTTGGTTGAGAAAG CCATGAATTCAGGTGAAAGTGA 167 G. triflora / G. scabra AB755724
SN28 (CACC)7 CAGCAGACAATCAAAACTTTCAA TAGTCTGTTCTGTGGGGAGTGA 166 G. triflora / G. scabra AB755725
SN39 (AC)11 ATTCTGCTCTAGCCTTCCCTCT GAACCACATGTCCTTCATCACT 152 G. triflora / G. scabra AB755726
SN40 (CA)6 CCAAATGGAAAATATACAGCCA GTTCTGTTTAGGGCTTGGGGT 152 G. triflora / G. scabra AB755727
SN48 (AC)7 TGCTGTAATTTGTGTGGCATTT AATTTAAAAGCCAGCCTTAGCC 224 G. triflora / G. scabra AB755728
SN55 (AC)8 AGTTAAACCTGCAAAAATTGGG GTTTTTGTTTATACGCGCACAC 161 G. triflora / G. scabra AB755729
SN73 (CA)12 ACAAGAAGCCAGGTTCCACTTA TCCGATTTGAGTTGTATTGCAT 167 G. triflora / G. scabra AB755730
SN87 (CA)11 GCACACACACCACTCCATCTTA TGGATCAAGTTCATTGTTGCAT 175 G. triflora / G. scabra AB755731
SN124 (AG)12 ATGTAGGACTGAATGACCCGAC AGATGCAAAGCTTGTGGTTATT 154 G. triflora / G. scabra AB755732
SN143 (AC)10 CCAGAAAGGGTTTTAAATGCAA TCCTTTCAATTGCTTGAGTTTTT 151 G. triflora / G. scabra AB755733
SN157 (AC)11 CTCACCATCACTCGATACTGGA ACGGAAGTTTACGGTGATTCTG 171 G. triflora / G. scabra AB755734
SN175 (CA)8 CACCAACACAAAGTTAGCTCCA ACAGGCTTATGGGCTGTATGAG 162 G. triflora / G. scabra AB755735
SN181 (CA)6 TTCAGTTCCACCCACACTACAC ACACATGGTAGCTTCCCTTGAA 204 G. triflora / G. scabra AB755736
SN182 (AG)13 AATAGAGGCGTCTTCATCATCA CGTAACGATAAATCCCGCTAAA 151 G. triflora / G. scabra AB755737
SN186 (CA)6 TGGTCATTTTGTGGAGTTTCAG TGGCAGAAGAGGTGTAGAACAA 204 G. triflora / G. scabra AB755738
SN224 (AC)8 TATGCCTTTCGTGCTCTGACTA GGTGATAAGCTCTTATGTTGCG 151 G. triflora / G. scabra AB755739
SN238 (AC)12 AAAAGACCAAACTTTCCCTGAC GCTAAGCGAGCCTAAGATGTTC 154 G. triflora / G. scabra AB755740
SN260 (CA)8(TA)5 CACCATAACTCGAATGTCACTG AGCGGGCGTTACAATTAATATC 241 G. triflora / G. scabra AB755741
SN282 (AC)6 TGGCAGAAGAGGTGTAGAACAA TGGTCATTTTGTGGAGTTTCAG 205 G. triflora / G. scabra AB755742
SN285 (AC)12 CCACTGATTGATGCATTTCATA CGTTATTCTGTGCTTGAACCTG 157 G. triflora / G. scabra AB755743
SN327 (AC)11 CAGGAGTACAACTGAGGCAGAG ACCCAACTTCTCTCAAACGAAA 232 G. triflora / G. scabra AB755744
SN328 (CA)12 AATTCTCCTCTTCTGCTTTTGC TCAATTCATTCATTCAGAACCG 169 G. triflora / G. scabra AB755745
SN336 (AC)13(AT)9 AAAAGAAAAAGGATGTTTGAGCA GCAAGAAACACAACACAAGCAT 193 G. triflora / G. scabra AB755746
SN343 (CA)12 TGGTGCAACAGGTAGATAACACA GTTGCGTACTGACTCCTGTCTG 189 G. triflora / G. scabra AB755747
SN345 (AC)7 ACTAGACCCTCACCAAATGCC TGTCCCTATTCTGTTTATGCTCTT 181 G. triflora / G. scabra AB755748
SN355 (AC)8 GACTCCATATTGCACTGGACAA TCCCCCTCTGTACACATATCCT 214 G. triflora / G. scabra AB755749
SN381 (AC)6 GCAAAAGAAAGCTCAAACGAAT CACAATCTCTTGGTCCCTTTGT 172 G. triflora / G. scabra AB755750
SN388 (CA)11 CTGCACAAATAGCAAAAGCATC TACCCGACGATGGTAATTGTAA 167 G. triflora / G. scabra AB755751
SN463 (AC)8 GGAAGAACTGAAGCTTCTGGAG CAAGGAGACAACACTTGACACAG 164 G. triflora / G. scabra AB755752
SN527 (TC)4(AC)8 AGCTCCCAAAGTATCACTCCAA CTGACATTTTACCAAGCCACAA 185 G. triflora / G. scabra AB755753
SN563 (AT)7 CATGTCCTCTGTGAGGTCAAAA GTCGGATTTTGGAGATTCGTAG 158 G. triflora / G. scabra AB755754
SN578 (CA)8 TCCCCCTCTGTACACATATCCT GACTCCATATTGCACTGGACAA 214 G. triflora / G. scabra AB755755
SN583 (CA)10 TTTCATTGCACCTGGACATAAG AAAGTCAATGAATTCCAAAGGC 151 G. triflora / G. scabra AB755756
SP1 (CA)13 ATGATGATTGGTCAGCCTCGG TGCTGGTTTGGTATTGAACTCTTCG 216 G. triflora / G. scabra AB755757
SP8 (AC)12 CTCTGCAACCAAACAATACCCCAT GGAAGGGGATGAATCGAGGAGTTA 327 G. triflora / G. scabra AB755758
SP15 (GA)17 GGATTTCGAGCGATTTTCTACTC GCAGAAGTTTTCCTTACGATGG 248 G. triflora / G. scabra AB755759
SP17 (AC)7 AAAACTCAGGAAAGCCGCAATA AATAGCCTCCCAAGCACCCTATAA 181 G. triflora / G. scabra AB755760
SP21 (AC)13 GGGACCAACACCATTATTTCCCTT GGAAGATCACATTTATGCCCCTCA 307 G. triflora / G. scabra AB755761
SP28 (TG)12.(GA)26 CCGCGTAAGTGGCATACTCATAA GTTACTTCCTTCAACCAGGGTATCTG 334 G. triflora / G. scabra AB755762
SP29 (AC)10 TGTAGTTGAGCAAGCCAAATCTGC GTGTAAGCCCAATAAGTCAATTCATGC 212 G. triflora / G. scabra AB755763
SP37 (AC)11(CA)6 CAGAAGGCTGGGGTCTACGAAATA CCTAGTGGGCTGGTTGGGTTTAG 250 G. triflora / scabra AB755764
SP43 (AC)15 ACTTGGGGCAGCAGAAACTTAACA TTGACCTAACATCGGTGCGAGAAT 107 G. scabra AB755765
SP44 (CA)8.(TA)11(CA)12 CGAATAAAAGGAACCGAACCCAAT AAGGGACGCCGCTACTTTCTACAG 281 G. scabra AB755766
SP47 (CA)11 GAAAGTTGAATTACTTGCAGGCTC TTCATATTAGACGGGTTTGGGTC 280 G. scabra AB755767
SP48 (AC)10 CCGATTCAACGCCTAGCAACT TCAAGAAACACGATACTGATGTGGG 271 G. triflora / G. scabra AB755768
SP49 (AC)10(AT)6 TCCGTTGTTCTTCGTAAAGGTTGG AGAGTGATTTCTTCTGGCTCGTTTCTT 337 G. triflora / G. scabra AB755769
SP52 (AC)14 CTGAATACAAGGTTTAGCTCCTTCA ATTAGCTCGGTTTTGCACTTAGAC 291 G. scabra AB755770
SP53 (AT)6 GCCGTATCCAACAAAAGAAACA TTACATTCCTCCCACTTAAAAGCC 322 G. scabra AB755771
SP57 (TA)12(GA)19 CGTGTAATTCGGTTAAATCCCTTCC AAAAGTGGTTATTCGGTTCGGGTT 231 G. scabra AB755772
SP58 (AG)17 GATGCTAGATGGGCTAGAGGAAAGA CAGTGCAAAGCAACTCGATAAGGT 129 G. scabra AB755773
SP61 (CA)13(TA)9 ACCCTCACTAAACCTTCACAGCGT CACAGAGCATATTACCGCTTCTTGA 226 G. scabra AB755774
SP63 (AC)7 AGGAACAATCTTGACTAGCCTCGG GAAGTGAGAGTTGGATTAGGGTGAAAA 264 G. triflora / G. scabra AB755775
Tdssr3 (AG)17 TCAAAAGCTCAGTAACTAAACCTTCA CCCAATAACAGTATAAGGACCAATCT 271 G. triflora / G. scabra AB755776
Tssr3 (CAA)7 CATGTTGATAAAGACTGGAAAGAATG CCAAAACTAGTCCAGGTAAAATTCTC 154 G. triflora / G. scabra AB755777

Nakatsuka et al.

Nakatsuka et al. BMC Genomics 2012 13:672   doi:10.1186/1471-2164-13-672

Open Data