Table 4

Forward and reverse primer sequences used in quantitative real time PCR analyses
Cadidate gene 5’-3’ forward primer 5’-3’ reverse primer
rRNA 18S TTAGGCCATGGAGGTTTGAG GAGTTGATGACACGCGCTTA
Terpenoid metabolism TCCTGATCGCTTTCATCCTT AGATGGTTCATGGGGAACTG
PAR1 CACAGACGGGGCAAGTAGAT AGAGGATGACAGTGGGGATG
FMN reductase AGGTTCCGGAAACACTTCCT CAATTGCTGAGTTCGCCATA
Cellulose synthase AAGCCCCTCCCTCTCAAATA TCATCATCAAGCACACAGCA
Chalcone synthase TCCCACATCCAATCCTTCTC TTCCAGCAGTTCGGAATCTC
Thiolase CCCATTCCTTTGCCTCAATA CGGCTCTAGCCATACCAAAA
Malic oxireductase GTTTGTTTAGACGGCCGAGA AGGAAGCACCCTTTGAGGAT
HMB-PP reductase CAATGCAACTGAAGGAGCAA TTGGGAGCGAACATCCTATC
SNARE GGGTGGGCTCTTTGGATAAT TTAACTGCAACCCGTTTTCC
RING-HC Zinc Finger AAGCCACAAACCACGAAATC GAGATTGCCCTAACCGTGAA
DAHP synthetase CCACCAATGCATTCTGTCAC CCCTTTGACGCAATAAGAGC
Ricin B related lectin GCAGCCAAGAAAAACTCTGG ATTGGGTGCTTCACAAGGAG
ABA/WDS induced prt AAAAGCGACAAGCGTAAGGA CACGGCCAAGCTTAAAAGAG
Disease Resistance Prt GGTTGAATGTGCCCTCACTT GGGAAGCTTTAGGCTCGACT
Thaumatin CGGGggATACTCAGACTTGA GAATTGAACGGTCCACGACT
LEA GAGGATCACTTTGGCGAGAC AGTCTACAGCCGCACGAACT
RNA recognition motif GACTTTTCCTGGTGCTCTGC CAGGTATGCCCAGACCAGTT
Chlorophyllase GTAGGAGGAATTGGCGATCA AATCTTGGATCCACCACAGC
Sugar transporter CATGTTGATTATCGCGTTGG AACCCTACTGCCATTGTTGC
High Mobility Group CGCTTTCCAATAGGCTTGTC TGCGTTTCACTCTGTTACGG

Santos et al.

Santos et al. BMC Genomics 2012 13:599   doi:10.1186/1471-2164-13-599

Open Data