Table 2

Information for 10 SNPs in UGDH and allele frequencies in Chinese Holstein population
SNP number SNP name SNP location Position (BTA 6) Alleles Frequency Primer and probe sequence
1 SNP Ex12-3 Exon 12 60966191 A/T 0.40/0.60 F: ATTTCTCGTCCCCCTGAATTGAG
R: ACGTGGCAGCATAGACAGAAAA
P: AAGGCCACACACTGT-MGB
2 SNP Ex12-2 Exon 12 60966411 C/G 0.42/0.58 F: GTACTCTTGCATGGGAAGTTCTACA
R: CGCTAAGTTGTGTCTGACTCTGTTA
P: ACTGTAGCCCGCCAAG-MGB
3 SNP Int11-1 Intron 11 60969505 A/C 0.39/0.61 CAAACAAATG [A/C] AACAAAACCA
4 SNP Ex11-1 Exon 11 60969627 C/T 0.66/0.34 F: CCTGTATATGCTCTAATTATTTCTCTGGTTCTT
R: CGTCAAAGATAAAGGCTGGTTTCAG
P: CATTTTTTTATGAATACGTTCAT-MGB
5 SNP Int9-3 Intron 9 60969880 C/T 0.59/0.41 AAATCACTCC [C/T] CTCTTACTCC
6 SNP Int9-2 Intron 9 60969929 G/A 0.46/0.54 TCAGACTCTC [G/A] ATTCCTCCTG
7 SNP Int5-1 intron5 60975997 T/C 0.91/0.09 GAGAAATAAG [T/C] CCTTGGCTTA
8 SNP Inti3-1 Intron 3 60979545 T/C 0.32/0.68 AGCCATAGCA [T/G] TACTTAGTAT
9 SNP Ex1-2 Exon 1 61000215 A/C 0.75/0.25 TGGTTGCAGC [A/C] CTCGGTGCCT
10 SNP Ex1-1 Exon 1 61000233 G/A 0.09/0.91 GAGCCGAGGA [G/A] ATAGAAGTGG

Note:

Genotyping platform: ABI7900, SNP 1, 2, 4; Mass Spec, SNPs 3, 5–10.

Xu et al.

Xu et al. BMC Genomics 2012 13:590   doi:10.1186/1471-2164-13-590

Open Data