Table 3

Novel miRNAs identified in alpaca skin
Name Sequence MFEI
Alpaca-novel-82 TCGCTCTCCTGCTCGCTCTGC 0.9789
Alpaca-novel-60 TCTGGAGGACGCCGCTCGCGCTC 0.9811
Alpaca-novel-56 GAATGGTGCTCCCTGGAATTGT 0.9974
Alpaca-novel-24 AGGGAACCTTGAAAAGCTGAAG 0.9986
Alpaca-novel-83 CAGGACCTGGGGACACCATTGT 1.0079
Alpaca-novel-37 TGTTTCTCAGAAGACTGTAGT 1.0155
Alpaca-novel-17 TGAACGGGGCCCTTCTGGTAG 1.0246
Alpaca-novel-61 CCTCACCTGTCATTCTCCCAGA 1.0324
Alpaca-novel-31 ATTGGCATGTCCTGGAATGAG 1.0554
Alpaca-novel-53 CCAAACCAGTTGTGCCTGTAG 1.0602
Alpaca-novel-45 ACTTTGGATTTGAGTCTCTGGT 1.1026
Alpaca-novel-8 ACAAAGTTGGCTGCCTGTGAGC 1.1197
Alpaca-novel-9 TTGGTTGAATACGTGGATGTGG 1.1877
Alpaca-novel-33 ATCCGTGGTTGGTTGAATATGC 1.2365
Alpaca-novel-32 TGAATGGCACCTTATGAGTAGA 1.2418
Alpaca-novel-76 AACTCAGTGTCAGATAGGAAGA 1.2434
Alpaca-novel-27 TTAGTGATGTTGGTTAAAAGAG 1.3272
Alpaca-novel-44 TCTGAAATTTAAATGTAACCGG 1.3920
Alpaca-novel-43 TTGTTGTTGGTTGAATAGTATT 1.5895
Alpaca-novel-68 TAATAGGTGATCAAATGAATGA 1.9358
Alpaca-novel-81 ATTGATCTTTGACTATAACTG 2.0412
Alpaca-novel-8 ACAAAGTTGGCTGCCTGTGAGC 2.4490

MFEI, MFE index.

Tian et al.

Tian et al. BMC Genomics 2012 13:555   doi:10.1186/1471-2164-13-555

Open Data