Table 5

Primers used for recombinant plasmids construction
Name Vector Sequence (5'-3')
Nsmce1 pGEX-4 T1 Sense: CG GGATCC ATGGCTTCCGGCGTGATC
Antisense: CG GAATTC CTAGTGCTGCCGGGTCCGTAA
pEGFP-N1 Sense: CG GAATTC ATATGGCTTCCGGCGTGATC
Antisense: CG GGATCC TTGTGCTGCCGGGTCCGTAA
pFLAG-CMV4 Sense: CG GAATTC TATGGCTTCCGGCGTGATC
Antisense: CG GGATCC CTAGTGCTGCCGGGTCCGTAA
Rnf126 pGEX-4 T1 Sense: CG GGATCC ATGGCCGAGGCGTCGCCG
Antisense: CG GAATTC TCAGGAGTTGCTTGTGGCG
pEGFP-N1 Sense: CG GAATTC ATATGGCCGAGGCGTCGCCG
Antisense: CG GGATCC TTGGAGTTGCTTGTGGCG
pFLAG-CMV4 Sense: CG GAATTC TATGGCCGAGGCGTCGCCG
Antisense: CG GGATCC TCAGGAGTTGCTTGTGGCG
Rnf151 pGEX-4 T1 Sense: CCG GGATCC TTCCTGTGTTCTGTCTGCCA
Antisense: GC CTCGAG CCTTCATAAGACACTTTGGC
pFLAG-CMV4 Sense: CG GAATTC GATC ATGAGTGGTGG
Antisense: CG GGATCC TCATAAGACACTTTGGC
Znrf4 pEGFP-N1 Sense: CCG GAATTC CCATGGCGCGGTTTGCGTG
Antisense: CCG GGATCC CTGGAG AGCT CGGA AGT CGC TTC
pFLAG-CMV4 Sense: CCG GAATTC CATGGCGCGGTTTGCGTG
Antisense:CCG GGATCC TCAGGAGAGCTCGGAAGTCGC TTC

Hou et al.

Hou et al. BMC Genomics 2012 13:495   doi:10.1186/1471-2164-13-495

Open Data