Table 4

Primers used in RT-PCR analysis
Name Product length Sequence (5'-3')
Action 480 bp Sense: ATATCGCTGCGCTGGTCGTC
Antisense: ATATCGCTGCGCTGGTCGTC
March11 321 bp Sense: ATGAGCGACGAGGGCAAAAAAC
Antisense: CTACTGAACTTTCTCAACCAGT
Nsmce1 830 bp Sense: ATATGGCTTCCGGCGTGATC
Antisense: TTGTGCTGCCGGGTCCGTAA
Pcgf6 698 bp Sense: AAGCCTGCTGCTCCACA
Antisense: TGACCCACCCACCTCAA
Rnf126 924 bp Sense: ATATGGCCGAGGCGTCGCCG
Antisense: TTGGAGTTGCTTGTGGCG
Rnf19b 407 bp Sense: AGCGGAAGCCCTACAGA
Antisense: CCACCACCAGCACCATT
Rnf151 519 bp Sense: GCCGCCTACAAGTCAAG
Antisense: GCCTGGGTTCAGTGTTTA
TrimL1 1850 bp Sense: TGATGTCCAACCATGAGA
Antisense: CAGATGTGGCAGATGATAAG
Trim42 816 bp Sense: ACCAATCTGAAGTGCTACTA
Antisense: CTACAGGTCATTATCAAT
Trim69 1517 bp Sense: CAAGTTTCATGGAGGTATC
Antisense: ATCTGTGGATGTACGATGTG
Znrf4 876 bp Sense: CATGGCGCGGTTTGCGTG
Antisense: TCAGGAGAGCTCGGAAGTCGCTTC

Hou et al.

Hou et al. BMC Genomics 2012 13:495   doi:10.1186/1471-2164-13-495

Open Data