Table 1

Previously published genomic SSR markers mapped inArachis duranensis
Universal Name Original Name Forward (5′-3′) Reverse (5′-3′) Reference
GM7 Ah1TC1D02 GATCCAAAATCTCGCCTTGA GCTGCTCTGCACAACAAGAA Moretzsohn et al. 2005
GM10 Ah1TC1E05 GAAGGATAAGCAATCGTCCA GGATGGGATTGAACATTTGG Moretzsohn et al. 2005
GM13 Ah1TC1H04 CATTACTTCCTAGGTTTGTTTTCCA ATGGCGTGACAACGGAAC Moretzsohn et al. 2005
GM16 Ah1TC2B01 TTGCAGAAAAGGCAGAGACA GAAAGAAGCTAAGAAGGACCCATA Moretzsohn et al. 2005
GM19 Ah1TC2C07 CACCACACTCCCAAGGTTTT TCAAGAACGGCTCCAGAGTT Moretzsohn et al. 2005
GM22 Ah1TC2D06 AGGGGGAGTCAAAGGAAAGA TCACGATCCCTTCTCCTTCA Moretzsohn et al. 2005
GM24 Ah1TC2E05 GAATTTATAAGGCGTGGCGA CCATCCCTTCTTCCTTCACA Moretzsohn et al. 2005
GM28 Ah1TC3A12 GCCCATATCAAGCTCCAAAA TAGCCAGCGAAGGACTCAAT Moretzsohn et al. 2005
GM32 Ah1TC3E02 TGAAAGATAGGTTTCGGTGGA CAAACCGAAGGAGGAACTTG Moretzsohn et al. 2005
GM38 Ah1TC3H02 CTCTCCGCCATCCATGTAAT ATGGTGAGCTCGACGCTAGT Moretzsohn et al. 2005
GM58 Ah1TC4G06 ATTTCACATTCCCTAGCCCC CATCGACTGACTTGAAAAATGG Moretzsohn et al. 2005
GM59 Ah1TC4G10 TTCGGTCATGTTTGTCCAGA CTCGAGTGCTCACCCTTCAT Moretzsohn et al. 2005
GM66 Ah1TC5D06 GAAATTTTAGTTTTCAGCACAGCA TTTTCCCCTCTTAAATTTTCTCG Moretzsohn et al. 2005
GM68 Ah1TC6E01 CTCCCTCGCTTCCTCTTTCT ACGCATTAACCACACACCAA Moretzsohn et al. 2005
GM69 Ah1TC6G09 GGAGGTTGCATGCATCATAGT TCATTGAACGTATTTGAAAGCTC Moretzsohn et al. 2005
GM71 Ah2TC7A02 CGAAAACGACACTATGAAACTGC CCTTGGCTTACACGACTTCCT Moretzsohn et al. 2005
GM74 Ah2TC7E04 GAAGGACCCCATCTATTCAAA TCCGATTTCTCTCTCTCTCTCTC Moretzsohn et al. 2005
GM76 Ah2TC7G10 AATGGGGTTCACAAGAGAGAGA CCAGCCATGCACTCATAGAATA Moretzsohn et al. 2005
GM83 Ah2TC9C06 CAAATGGCAGAGTGCGTCTA CCCTCCTGACTGGGTCCT Moretzsohn et al. 2005
GM92 Ah2TC11A04 ACTCTGCATGGATGGCTACAG CATGTTCGGTTTCAAGTCTCAA Moretzsohn et al. 2005
GM96 Ah2TC11C06 TCCAACAAACCCTCTCTCTCT GAACAAGGAAGCGAAAAGAA Moretzsohn et al. 2005
GM117 Ah2AC3C02 TCTAACGCACACAAATCGAA CTTGTACCTGCGCCATTCT Moretzsohn et al. 2005
GM126 AS1RI1F06 TGTCTCTCTTCCTTTCCTTGCT CCTTTTGCTTCTTTGCTTCC Moretzsohn et al. 2005
GM162 AS1RN9C02 CGTTACACTGAGCCAGCAACTC ACGGCGGCGATAGTTTCA Moretzsohn et al. 2005
GM170 AS1RN11E05 CTCGGTCCAGAAAACACAGG GTAGAGGCGAAGAAGGCAGAG Moretzsohn et al. 2005
GM218 gi-30419832 GCCACTTTATTCTAAGCACTCC AAGAGACCACACGCTCACA Moretzsohn et al. 2005
GM226 gi-30419936 TCACAGATCCATAGACTTTAACATAGC CCGGTGTGGATTCATAGTAGAG Moretzsohn et al. 2005
GM255 pPGPSeq4H6 CCAACATTGCAGAAGCAAGA CAAAGAGAGGCACACCACAA Moretzsohn et al. 2005
GM286 Ah-193 CTTGCTGAAGGCAACTCCTACG TCGGTTTGTCTCTTTGGTCACTC Moretzsohn et al. 2004
GM324 Ah-649 GGAAATGCCAAATCCATCCTTC GTTGTTCGGTGTGAAAACGGTC Moretzsohn et al. 2004
GM328 Ah-671 AGAAAGAGCACGGGACATTACC ATGAATGAGTGGTCATACGCGA Moretzsohn et al. 2004
GM565 pPGSseq17E3 TTTCCTTTCAACCCTTCGTG AATGAGACCAGCCAAAATGC Ferguson et al. 2004
GM664 GM664 CTTCACCTCCAAAATCAACCA ACCGCTGACATTTGATTGTTC Guo et al. 2011
GM671 GM671 TGGATGCTGTAAGGAATGGAC TTATCGAGCTTGCCTCAGAAA Guo et al. 2011

Markers were renamed in order to follow a unified marker nomenclature. The complete list of renamed markers can be found in Guo et al. (Guo Y et al: Comparative mapping in intraspecific populations uncovers a high degree of macrosynteny between A-and B-genome diploid species of peanut, Submitted).

Nagy et al.

Nagy et al. BMC Genomics 2012 13:469   doi:10.1186/1471-2164-13-469

Open Data