Table 3

The novel miRNAs of the miRDeep2 pipeline
Novel miRNA (miRBase name) Mature sequence Star sequence Coordinates/strand Raw reads in Necrotic Raw reads in Unaffected Novoalign
Mature Star Mature Star Necrotic VU
miR-d1 miR-7142 uuuguuggcuccucugaaguga acucuccgaggggccuucaaggg chr2:6684269–6684379:- 30 1 49 0 15 8
miR-d2 miR-7138 gaggacuggccuugcagggugc ucccagcaaguguccauccaucu chr2:69969933–69970043:+ 21 9 1 4
miR-d3 miR-7137 agcuggucugggaguucccggg cgggggaacucccagaccagc chr3:9289209–9289319:+ 25 8 5 5
miR-d4 miR-7135 aucugucugugucucugagcag ucucugagacacugacugugg chr3-25819302-25819413:+ 5 3 72 8 4 14
miR-d5 miR-7134 augcggaaccugcggauacgg auguccgcggguucccuaucc chr5:4391270–4391380:- 8,622 32 20,234 161 5413 3690
miR-d6 miR-7139 uagggcacaggaugggaugagg ccauuccuucgucugugcacuag chr5:97203430–97203540:+ 12 4 2 3
miR-d7§ miR-2320 uggcacaggguccagcugucgg cgaugauggucccuguguuugg chr6:43886614–43886725:- 28 10 224 37 19 32
miR-d8 miR-7136 ucugguccagacacuguggagc ucucaguguuugaaccagaagc chr7:8508420–8508531:- 23 14 3 7
miR-d9 miR-7143 ucugcacuugaagcugagacuga aagcucagcucugaagugcagagg chr9:27778763–27778873:+ 11 0 1 2
miR-d10 miR-7144 acuuucccgggauuuggagcgc gcuccuugucccgagaccgcga chr11:74962849–74962958:+ 10 0 11 2
miR-d11 miR-7141 gacgguuuggacguuaagaac ucuuaacguccaaaccguucc chr15:129475498–129475608:+ 21 0 1 4
miR-d12 miR-7140 aaugaugccccuuagaguugag caacucaagggggcaucauuca chr17:37143888–37143999:+ 30 1 11 2 14 2

Predictions are confirmed by the unique mappings from Novoalign and either conserved structure according to RNAz or by having reads in both mature and star. 12 miRNAs are novel according to mirBase. Read counts in this table are based on raw reads and refer to the Bowtie mapping used by miRDeep2. VU stands for visually unaffected. One miRNA (miR-d7) marked with a § is mir-2320, found in mirBase17 so cannot be any longer considered novel.

Podolska et al.

Podolska et al. BMC Genomics 2012 13:459   doi:10.1186/1471-2164-13-459

Open Data