Table 1

Primers and co-ordinates for all PCR amplicons and Probes (hg18, GRCh36)
ID Forward primer sequence Reverse primer sequence Co-ordinates (GRCh36) Length Type
HDLBP GAGCTCATCCTCCACTTGGG GAACTTGGTGAGAAGTGCGG chr2:241,855,412-241,860,011 4600 TUF
HDAC4 AGGTGCTAGATTTGGACGGG GTGTGTGTTAGGGGGTCAGG chr2:239,860,758-239,863,570 2813 TUF
CAPN10 ATCTGGCTACAGGCATGGGC GAGAGCCCAGAAGTTCCAGC chr2:241,173,030-241,175,779 2750 TUF
PSCDBP GAGGCAATCACATGAGCAGG CTGCTAAGTGGATGAATGGTGG chr2:158,003,567-158,006,035 2469 Non-TUF
MARCH7 GGGAAATATGGGTTGGGAAACTG ATGGTCTCCGTCTTCTTCGG chr2:160,329,568-160,332,075 2508 Non-TUF
RBMS1 AGTAAGGAGATGAGGGGTGG ACAGGTTTTGGTGGGAGAGG chr2:160,889,938-160,892,713 2776 Non-TUF
2n13 GCAGACTAATGGGGATGAGG GCCTATCTGGAAAAATAGAC chr2:241,151,005-241,151,733 729 TUF
chr13:31,949,825-31,950,179 355 Non-TUF
8n6 TTGAGTCAGCCACAGAGG CCTGGTGACAGAATGACC chr8:142,286,472-142,286,937 466 TUF
chr6:89,689,978-89,690,367 390 Non-TUF
8n3 GCTTCATCCAGCTTCAACC AGCAAAGTGACACTCAGTGC chr8:145,234,022-145,234,464 443 TUF
chr3:134,693,119-134,693,550 432 Non-TUF
2n1 CACCCCAGTGAGTAAGCTGC AGGGTGATCGCTTCTGACC chr2:241,707,017-241,707,258 242 TUF
chr1:37,721,785-37,722,026 242 Non-TUF
5nX ATCTAGGCTCAGGAGAGAG TAAACATCTTAAAATGGCCT chr5:179,593,910-179,594,270 361 TUF
chrX:63,694,585-63,694,959 375 Non-TUF
9n14 CAGAGAGCAACCTGGCTC CTGCCTCCTTGTTTGGC chr9:139,562,111-139,562,372 262 TUF
chr14:94,217,995-94,218,256 262 Non-TUF

Veal et al.

Veal et al. BMC Genomics 2012 13:455   doi:10.1186/1471-2164-13-455

Open Data