Table 4

Gene short names, gene/EST ID and PCR primer sequences (5’-3’)
Gene Gene ID 5’-3’ forward primer sequence 5’-3’ reverse primer sequence
hba NM_001082389.2 GCAGCCACGGTGGCGAGTAT GTGGGACAGGAGCTTGAAAT
eif41a ENSGMOG00000012412 GACGATTGAGTCGATAGTGAATGC CGCCCACCTGTTCTGTAAGG
tbp ENSGMOG00000012435 CACAGCTGCAGAACATTGTATCAA TGACGGCCGCAAAACG
t ENSGMOG00000017391 CAACGAGATGATCGTCACCA TGGCTGCTGATCATCTTCTG
orp JK781166.1 GCTTCGGCTCCTTTTTATTTTTT CCACTTGTTGTTCCGCAGAGT
gmnn ENSGMOG00000008149 GATGGTATCTCAAATGAAGCCTATGA CGCTCGTCTGCCACTTCTTT
stmn1 ENSGMOG00000005322 GAAACTATTGGAGATATTCAGGTTAAGGA GCAGGAGCAGCCAGAATCAC
siva JK777503.1 GAAGCACAGCCTTCTCAACCA CCAATGAGCGTTTGTCCCTTT
gadd45gip1 ENSGMOG00000012967 CCGCTGAAACTGAACCTCAAG GCCATTCGGGCGTCTTCT
afp ENSGMOG00000002484 GAGCTGATGGCGACTGTTCA CCTCCCGTCCTCGATGATG

When possible, sequences are listed with an Ensembl gene ID. Otherwise the sequences are listed with GenBank EST ID (orp and siva) or mRNA ID (hba).

Kleppe et al.

Kleppe et al. BMC Genomics 2012 13:443   doi:10.1186/1471-2164-13-443

Open Data