Table 2

Precursors of conserved and novel miRNAs from globe artichoke

miRNA

Sequence

pre-miRNA length

MFEI

Accession


cca-miR156a

UGACAGAAGAGAGUGAGCAC

102

1.29

JN381965


cca-miR156a*

GCUCACUGCUCUAUCUGUCACC


cca-miR156b

UGACAGAAGAGAGUGAGCACA

118

0.88

GE609552


cca-miR157a

UUGACAGAAGAUAGAGAGCAC

98

1.20

JN381966


cca-miR160-1

UGCCUGGCUCCCUGUAUGCCA

96

1.13

JN381967


cca-miR160-2

UGCCUGGCUCCCUGUAUGCCA

93

1.00

JN381968


cca-miR164a

UGGAGAAGCAGGGUACGUGCA

83

0.99

JN381969


cca-miR166d

GGAAUGUUGUCUGGCUCGAGG

86

1.12

JN381970


cca-miR166d*

UCGGACCAGGCUUCAUUCCUU


cca-miR167a

UGAAGCUGCCAGCAUGAUCUGG

218

0.77

GE597437


cca-miR168a

UCGCUUGGUGCAGGUCGGGAA

118

0.83

JN381971


cca-miR169a-1

CAGCCAAGGAUGACUUGCCGG

102

0.94

JN381972


cca-miR169a-2

CAGCCAAGGAUGACUUGCCGG

99

0.91

JN381973


cca-miR171a

UGAUUGAGCCGUGCCAAUAUC

92

0.82

JN381974


cca-miR172a

AGAAUCUUGAUGAUGCUGCAU

79

1.04

JN381975


cca-miR319c

UUGGACUGAAGGGAGCUCCCU

198

1.11

JN381976


cca-miR390

AAGCUCAGGAGGGAUAGCGCC

88

1.39

JN381977


cca-miR393a

UCCAAAGGGAUCGCAUUGAUCC

142

0.97

JN381978


cca-miR394

UUGGCAUUCUGUCCACCUCC

211

0.81

GE603351


cca-miR395a

CUGAAGUGUUUGGGGGAACUC

80

0.97

JN381980


cca-miR395b-1

CUGAAGUGUUUGGAGGAACUC

92

1.17

JQ029164


cca-miR395b-2

CUGAAGUGUUUGGAGGAACUC

92

1.04

JQ029165


cca-miR396a

UUCCACAGCUUUCUUGAACUU

119

1.38

JN381981


cca-miR396a*

GUUCAAUAAAGCUGUGGGAAA


cca-miR396b

UUCCACAGCUUUCUUGAACUG

110

1.04

JN381982


cca-miR398a

UGUGUUCUCAGGUCGCCCCUG

100

1.15

GE610628


cca-miR408a

UGCACUGCCUCUUCCCUGGCU

107

0.70

GE605886


cca-miR399a

UGCCAAAGGAGAUUUGCCCUG

83

1.12

JN381983


cca-novel-1-5p

UGUCUAAGACAACUCCUUGGA

117

1.17

JN381984


cca-novel-1-3p

CAAGAAGUUGUCUUAGGCAUG


cca-novel-2

AUACGACAAAUAGAACAAAUAAAC

71

0.80

JN381985


cca-novel-3

ACGAAAACAUGUUGGUCUCACGUG

217

0.78

JN381986


cca-novel-4-5p

UUGCAAGUAUCCGGAUUUAAA

210

0.78

JN381987


cca-novel-4-3p

UUAAAUCCGGAUACUUGCAAC


cca-novel-5

AAAGGGGACAAUAUCUGGUACGGU

110

1.38

JN381988


cca-novel-6

CACGAAAACAGACUGGUCUCACA

222

0.94

JN381989


cca-novel-7-1

UGAGAAGCGUAAGAAGGGAUC

157

0.88

JN381990


cca-novel-7-2

UGAGAAGCGUAAGAAGGGAUC

98

0.92

JN381991


cca-novel-7-3

UGAGAAGCGUAAGAAGGGAUC

171

0.72

JN381992


cca-novel-8

AUGGACGUGUUAUUCAUCAUGAAU

122

1.15

JN381993


cca-novel-9-5p

AUCUUGUAACAUUUGAUGAUGUGG

122

1.19

JN381994


cca-novel-9-3p

AUCCACGUCAUCAAAUGUUACAAG


cca-novel-10-5p

UCUUUAUGUCACGAUGUAUGAC

255

0.86

JN381995


cca-novel-10-3p

CAUGCAUGGUGAUAUAAAUAGC


cca-novel-11

GAAGUUUCAAGUGUAAAAAAGUGG

116

1.58

JN381996


cca-novel-12

UCUGAAACUCAAGAACACGUUG

81

1.06

JN381997


cca-novel-13-5p

UGAAAGGAAUCAUGAACGUGA

115

0.83

JN381998


cca-novel-13-3p

UCACGUCCAUUGUCCCUUUCA


cca-novel-14

AAGCGUAAGAAGAGAUCUGAACC

157

0.80

JN381999


cca-novel-15

AUAAGGAGAGUUAAGCUGAGAAGC

184

0.72

JN382000


cca-novel-16-5p

GUAAGAAGAGAUCUCCACCCUUGG

162

0.84

JN382001


cca-novel-16-3p

AUCAAGGGUUCAGAUCUCUUCUU


cca-novel-17

UAUGGUGAGAAGGGUAAGAAG

169

0.90

JN382002


cca-novel-18

UCUGGACGGUAUGCACAUGUGCAU

140

1.23

JN382003


cca-novel-19

UUCAAGAAAGCUGUGGGAAAA

124

1.34

JN382004


cca-novel-20-5p

CAUGCUUGUGAUCAAAUGAUG

179

0.84

JN382005


cca-novel-20-3p

UCAUUUGAUCACAAGCAUGAG


cca-novel-21

GGUUAGGUUGAUCGGGUUGAAGAC

98

0.88

GE597304


cca-novel-22-5p

UGGAAUUGGGUGCUUCGGAAGA

116

0.84

GE599895


cca-novel-22-3p

UUCCGAGGCCACCCAUUCCAAC


MFEI: minimal folding free energy index

De Paola et al. BMC Genomics 2012 13:41   doi:10.1186/1471-2164-13-41

Open Data