Table 1

Comparative bovine primers used for identification of the positive ovine BAC clones in the genome region between MHC Class IIa and IIb*
Name Gene symbol Primer sequence (5’→3’) Product(bp) Bovine template sequence Positive Ovine BAC clones
S001 VPS52 F: ATCAATCAGACGATTCCCAACG 246 UniSTS:279053 12 H14;12I12;12 J14; 12 K14;120P21
R: ATCAGAAACACAAGCTGCTCCT
S002 ZBTB22 F: TCCTACGACTTACTCCCTCC 250 UniSTS:66823 12I12;12 J14;258 F9; 289 G18
R: GGGTCAGGTGGTTGTAGTCT
S003 KIFC1 F: GAGACTGTCCGAGACCTGCT 1242 UniSTS:BV104878 170 G9;217 M14;289 G18
R: CTGTGACTACGCGACGAGC
S004 Loc100139397 F: GGTCATCATGGAGGCAGTCT 756 Exon 6: NC_007324 19 H17
R: CGTTCTCCTAAGCCATATGC
S005 BAK1 F: CATTGCATGGTGCTAACCGA 293 Exon 6: NC_007324 None
R: CAAGCTCAGCCTTCCAGAAC
S006 IHPK3 F: ATGTATGAGAGCTTGGCACG 1000 UniSTS:267905 212D3
R: TCAGCTTGTACTCTTCCAGGG
S007 LEMD2 F: ACGTCTACCGCAACAAGCTG 227 ENSBTAE00000168818: Exon 1 None
R: GTCTCCGATGTCACCGTAGG
S008 Loc790333 F: GACTGCGAGGTGCCGAAGAA 776 Exon 94 M24;114B22
R: GTGGACGGCTACACCTGCAA
S009 HMGA1 F: CTCATGCTCTCATTCGGACA 625 ENSBTAE00000364012: Exon 6 57 M5
R: CAGAACAGGAGGCAATGAGG
S010 NUDT3 F: TGAAGTGGAGAGCCTCACAA 688 ENSBTAE00000213256: Exon 5 14E10;300 G8
R: CTTCTCAGCAGACGATGGAC
S011 COX5B F: GTCTCCGTGGTGCGCTCTAT 324 ENSBTAE00000098033: Exon 1,2 130 G21;130 M2;170 K16
R: GGTGTGGCACCAGCTTGTAA
S012 PACSIN1 F: AAGCCAGCAACAGTAGCAGC 683 ENSBTAE00000336066: Exon 10 253I24
R: TCGTTACCTGGAGACCAAGC
S013 C6orf106 F: AGTGAGCGGCTGAGAGAGTT 266 ENSBTAT00000048861: Exon 1 None
R: AACTCGGAGATGAGCACGTC
S014 SNRPC F: CCAATGATGAGACCTCCTGC 147 ENSBTAT00000034155:Exon 6 119P19;157 K19;223 N7; 227 J17;232 G24
R: CAGAGTCACAGCACCATGAT
S015 TAF11 F: TGGATGTGTGTGAGAAGTGG 561 ENSBTAT00000022463: Exon 5 194 L19;215 J4;232 G24;234C5
R: TCATGGTGGAGTATCACAGG
S016 ANKS1A F: CGAGGAATGGCCACAAAG 894 UniSTS:BV105378 124P23;320A1
R: ATCGGTCTTGCCAAACAAAG
S017 TCP11 F: ATCAGCGGATCCACTTGTTC 373 ENSBTAT00000022467: Exon 11 24D11
R: CTGGAGCTCACACACGAGGT
S018 DEF6 F: ACCACCAGCAGCTCCTTCAC 496 ENSBTAT00000036152: Exon 11 21 M13;66I6;124 K16; 193E6;206 L10
R: CCTGGCTTGCTTGTTGACTC
S019 PPARD F: GTTCCATGGTCACCTTCTCC 353 ENSBTAT00000023319: Exon 8 28D20;152A4
R: CCGTGAATCTCGCTTCTCTT
S020 TEAD3 F: CCCATCACAGCTGGATTTTA 145 UniSTS:180986 None
R: AAATGAAGTACTGTGCCCCC
S021 Loc540812 F: TGCACTGCAACTTCCTGAAC 263 Exon 95D10;119O20;158O6
R: GCACTGCAGGCTGACTATGA
S022 SRPK1 F: CAGACACTTACAGGACGTGG 273 ENSBTAT00000022396: Exon 11 269D12;285I5
R: TGAAGACTGGCACATCATGG
S023 SLC26A8 F: ACATCAGCACCGTCAGTCACC 222 UniSTS:476830 26A21;121O15
R: AGGCGATAGAGGACAAACCACAC
S024 MAPK14 F: GAATGGATAACAAAACACTT 196 UniSTS:279403 26A21;121O15
R: AGGCGATAGAGGACAAACCACAC
S025 MAPK13 F: AGAAGCTCAATGACAAGGCG 606 UniSTS:269171 121O15;154 M16
R: TTCCATTCGTCCACTGTGAG
S026 BRPF3 F: GACGCCTGCATCGTATTAGC 575 ENSBTAT00000017711: Exon 1 154 M16;250 L24; 278B11;281D9;300 J5
R: AGCCAGGTTGCAGATGTCAC
S027 PNPLA1 F: TCCTGAACGCTGTCAACCGA 449 ENSBTAT00000055658: Exon 7 78 M7;153 F9;268E18; 319O4;337 K13
R: CAGGTGGCTGTGCAGGTGAT
S028 Loc790226 F: CCATGACTCCGTAGACAAGA 483 Exon 3O16;9 G2;9 G3;9 H8; 10 N2;15B13;26D1
R: ACTGCCATAGCTACTGCTGC
S029 KCTD20 F: CGATGCAATCACTAAGCTGG 834 ENSBTAT00000027439: Exon 8 None
R: GCAGTTCTCATCCTTCGCAC
S030 RPS4Y1 F: TGCCAGCCTCTTGTCTCTCT 430 ENSBTAT00000036142: Exon 2 2A3;11 H24;63 N7; 82 N20;97O2;120P24
R: TACACCTGAGGAGGCCAAGT
S031 CDKN1A F: GGATCGCTAAGAGCCGGACA 861 ENSBTAT00000011001: Exon 3 None
R: GGCAGTCGCTGCTTGAGGTA
S032 PPIL1 F: AATGGTCAATGCGCCTGCTT 888 ENSBTAT00000003071: Exon 4 30O17;139 K9;198 M20;271C5
R: CACCAACGGCAGCCAGTTCT
S033 PI16 F: CCTAGCAACAGAAGCCTCAA 461 ENSBTAT00000002703: Exon 5 54O24
R: AGGCCAAGATCTCACTGCAA
S034 FGD2 F: CACCTTGGTGACCAACATTC 414 ENSBTAT00000018834: Exon 16 304 K7;318I17
R: ACTGCCATAGCTACTGCTGC
S035 PIM1 F: AAGCACGTGGAGAAGGACCG 490 UniSTS:463218 None
R: GACTGTGTCCTTGAGCAGCG
S036 TBC1D22B F: CTGTCCACCACTCCATGTCT 539 ENSBTAT00000018938: Exon 13 5 K4;26A20;49B1;98 G9
R: GGACATTCGGACGTGTAACT
S037 RNF8 F: TCTGAATGGTGTCTGGCTGA 708 ENSBTAT00000010959: Exon 3 None
R: TTCTCGAGCTGCTCCACTCT
S038 Loc509620 F: AGTGGCACACCGAAGCTC 666 UniSTS:267349 25P1;103D16;207 L11; 271 M7
R: AACTTCCTCTTGAAGCTTTTGC
S039 C23H6orf129 F: GGCAAGAGAACCGCAAGAAC 281 ENSBTAT00000016009: Exon 4 25P1;103D16
R: GCACGAAGTCCTTCTGGAGC
S040 MDGA1 F: TCTTGGCGTTGCAGAGATGA 228 ENSBTAT00000047505: Exon 16 None
R: TGTGCGTGTGTCGAACAACC
S041 ZFAND3 F: CGATTGGTTTAATTTTTTTTTTCA 200 UniSTS:34520 159 K21;185 L24;235B3
R: TGTGAAGTTTGTTAAATGTAAGGAA
S042 BTBD9 F: GATAGGTCTTACGCTGTTAG 155 UniSTS:279369 None
R: GAATGTACAGAATAGAAGTG
S043 Loc781915 F: AACCTCAAGTGCCTCTCCAG 714 Exon 67D11;70 N21;76E1; 240 K15;240O16
R: AACAAGTGTAGCCAGCCATC
S044 GL01 F: GATAGGTCTTACGCTGTTAG 155 UniSTS:279369 None
R: GAATGTACAGAATAGAAGTG
S045 Loc525414 F: GAAGAAGAGGTGATCGGTGTAGAG 216 UniSTS:476833 8 J2;13E21;24 K16; 24 N15;28 L5;112 N3
R: TTTCTCCTTCCCATACATTTCTGTG
S045b GLP1R F: CGAGTGTGAGGATTCCAAGC 418 Exon 4, 5 and intron 80 G15;138P3
R: GTAGCCCACCGTGTAGATGA
S046 C23H6orf64 F: GTCACAGCCACCATGGAGTC 415 ENSBTAT00000001425: Exon 2 19 F4;80 G15;138P3; 156B12; 336 L24
R: CGCAAGCTGTTCTCAGTCAA
S047 KCNK5 F: CTCCGACTCTGTGCTGGTGA 774 ENSBTAT00000014756: Exon 5 None
R: TACCACGCCTTGTACCGCTA
S048 KCNK17 F: AGAGTCCAGGCTCCTTCTAT 493 ENSBTAT00000013646: Exon 5 None
R: CTGCTATCCTCAGAGTTCCA
S049 Loc100139627 F: GTGGAGGGAACCTGCGGCAC 344 NC_007324.3: designed online 3 L3;51O8;189 L22; 253I5; 270 L14
R: AGGCCTCGGAAGAGCCCTGG
S050 Loc100138924 F: CTTGGTCTTGCGGGCCCCTG 493 NC_007324.3: designed online 145 G9;146 H11
R: CCAGGCTCTAGCCCTGCCCA
S051 DAAM2 F: CAGGGAGTGCTCTCAAAGGTAAAGG 307 UniSTS:476834 None
R: TCCTCCAGCCTGACTTCTCCTTC
S052 MOCS1 F: GGTCCAGGAAGGCTGAAGTG 661 ENSBTAT00000013792: Exon 11 None
R: GAAGGACGGATGGCTATGGT
S053 LRFN2 F: TTGTCATACACGGCGGTCCT 493 ENSBTAT00000023907: Exon 1 77E2;220 J8;325 J12; 325 J13
R: AGCTGAGCCTCGACCACAAC
S054 UNC5CL F: TGACCAACGAGCAGCCACAC 278 UniSTS:476835 None
R: GCAGCAGGAGGAGCCAGAAG
S055 NFYA F: GCCGATGAAGAAGCTATGAC 550 ENSBTAT00000013080: Exon 10 76 K24;118P22;136B19
R: CATGAGATGGAGCTTCCTTG
S056 TREM2 F: ACAACTCCTTGAAGCACTGG 229 ENSBTAT00000009568: Exon 2 86A4;178 L4;208 M19; 282 F4
R: TGGAGGCTCTGGCACTGGTA
S057 TREM1 F: CATCATTCCTGCAGCATGTG 515 ENSBTAT00000023397: Exon 4 30C8;73 K17;75A11; 75I21
R: GGCTGTGCCAGGTCTTAGTT
S058 LOC783024 F: CTGAGGACCAAGGCCATGCT 216 Exon None
R: TGGTGTGGCACTGCAGGAAG
S059 FOXP4 F: AATTATCGCTCCAAGAGATTCCAC 250 UniSTS:384935 112I1;144 K17;181 F9; 299P14;314 F18
R: CCCATCCTTGTCTCCTCTTTACAT
S060 MDFI F: GCTGTGTCCACTGCATCTTG 256 ENSBTAT00000025763: Exon 4 70B14;166C6;181 J11; 202B12; 229A10
R: GGTCAGGAGGAGAAGCAGAG
S061 PGC F: GAAATTCTCTGCTAAACCCCTTCA 268 UniSTS:385581 14 G18;24O7;24O10; 103 G9; 139 N14
R: TCATCTAAGCAGAAACACCAGTAAATG
S062 USP49 F: GATGGAGTTCATGTAGCAGGTGTT 260 UniSTS:385828 None
R: GGAGCGCAAGAAGGAGGAG
S063 BYSL F: TCAGAGGACCTGGAAGTGGA 538 ENSBTAT00000013326: Exon 7 3 M12;98 J10;182 F10
R: CTCTCATGCACAGCAGTGGA
S064 TAF8 F: TGGAGGAAGGAACTTGGTCACAGAG 228 UniSTS:476836 103 M11;133 J10;146 L22
R: GGTGCTTGAGGTTCGTTGAGTTGAG
S065 MGC137036 F: GAAGCAGGACCGTGAGCAGA 238 ENSBTAT00000017035: Exon 2 100O15;117E7;133 J9; 146 L22;171 L22;176P6
R: CTACGAGCGCCACAAGACCA
S066 TRERF1 F: GTGTGTCTGTTGCTGCGGTG 643 ENSBTAT00000020376: Exon 1 1O22;17 J12;79 H15; 81 J21;100O15;259 L15
R: TGGTCTAGGCTTGGCTGTTG
S067 Loc786000 F: TGGCAAGATGGCGGTGCCAG 379 NC_007324.3: designed online 6P21;32P14;142C8; 162E5;195C23;227D22
R: AGCAGCCTTGGCCCCACTCT
S068 UBR2 F: CTGCAAGCAACTGACCTCAC 169 ENSBTAT00000007833: Exon 2 6P21;129B6;162E5; 163E23;177 M6
R: CCAACTCAGGATCTTCACCA
S069 PRPH2 F: GTAGTGGACTCCAGGAACTTCG 232 UniSTS:279013 26 J6;26 L8;29 M14; 127A7;134B12;177A2
R: ACCACAGAGTCACCTGCTGAGA
S070 Loc540169 F: ATGAAAGGGTCAGGCGAAC 130 UniSTS:94727 144A13;164 L3;164 M2;164 M3;172O18;185 N10
R: ACAGAGCCGCTAACCGTG
S071 CNPY3 F: GAACAGTGGTCTGGCAAGAA 214 ENSBTAT00000021132: Exon 10 98 J16;172O18;185 N10;189O8;289 J21
R: GTTAGGCTCAGAGCTCGTCA
S072 CUL7 F: TTTCGACCTCGCTCTGAGTT 1,000 UniSTS:270008 74C2;189O8;289 J21; 325 K12
R: CTCCAGCATGTGCCAGTG
S073 PTK7 F: GACTCAGGAGCCTTCCAGTG 531 UniSTS:268417 54A6;127D14;142 L8; 163O23;204P7
R: CTGTATTGCAGCTTCCGAGG
S074 Loc540077 F: CTGAATACCTGATCCGATGG 417 Exon 54A6;142 L8;163O23; 204P7
R: GCATGTGCATGAGTAGGTCC
S075 Loc786439 F: GGCGTCTTTAATCAGGATTTGG 200 UniSTS:222501 None
R: AATCCAACACTTGAAACCGACA
S076 ZNF318 F: CTGTCTTCACTCGAAGCTCC 438 ENSBTAT00000013481: Exon 1 24 L23;66 G8;83 N5; 119 J9;162 F10
R: AGCTCCTACTTCGTTCCTCC
S077 TJAP1 F: GAGGACGAGGAAGAGCTGAA 654 ENSBTAT00000035977: Exon 12 None
R: CGTGCAGAGGATTGAAGGAG
S078 POLH F: GACAGCCACACACATAAGCA 497 ENSBTAT00000007900: Exon 11 68 F17;71 H18;74P6; 124 L6;250 J4
R: GTCTCACAGAGTCGGACACG
S079 MRPS18A F: AGTCGTGAGACCACTGCAGC 191 ENSBTAT00000056429: Exon 6 115P10;176 M14; 233 H10;278 K6;291I13
R: AGGACCTCCTGAGAGCCTGA
S080 VEGFA F: GATCATGCGGATCAAACCTCACC 326 UniSTS:471318 12B17;12 H11;30 L7; 63B18;124 J8;249D14
R: CCTCCGGACCCAAAGTGCTC
S081 MRPL14 F: TCAGAACTGCTCCATTCACG 182 UniSTS:64809 117 J15
R: CAACAACGTGGTCCTCATTG
S082 SLC29A1 F: GGTGGTCTTTGAGCACGACT 537 UniSTS:207086 None
R: CCGGAACAGGAAGGAGAAG
S083 AARS2 F: CACTGGAAGCACTGCTGACC 325 ENSBTAT00000018232: Exon 22 None
R: GCAGCCAGAACAGCCATGTA
S084 CDC5L F: CCAACTCAGTGGAGGACCAT 750 UniSTS:267825 134E15;147I12
R: GGCTTTGTTTCTGGATTTGG
S085 SUPT3H F: CTTCTGCCTGGAACTTGCACTTG 208 UniSTS:476839 23P23;80P15;110 F4;5;6
R: TGCTTACTGTCTCCCACCTAGATTG
S086 Loc536911 F: TACCAGCCACCGAGACCAA 309 UniSTS:280406 9 G19;9 H22;9I23;24; 59B8
R: AGAGGCTGTTTGACGCCATAG
S086b CLIC5(BM1258) F: GTATGTATTTTTCCCACCCTGC 158 UniSTS:56663 291I15
R: GAGTCAGACATGACTGAGCCTG
S087 ENPP4 F: GAACCAGCTCACCAATGTGT 595 ENSBTAT00000004547: Exon 2 72 M13;74O6;127 F7; 182 K12;299 N7
R: TCCTCTGCTTCACCACCTAA
S088 RCAN2 F: TCTTTACTGTCTGAGCCACC 132 UniSTS:69107 None
R: TACACTCAGAGCTAGTTTGC
S089 CYP39A1 F: AGGTGATGGTGGCAACTATG 200 UniSTS:15671 57E15;181B7;202D23; 213A17;261 M4
R: CATGTGTCCATAATTTGATTGC
S090 TDRD6 F: GAGTTCTTCCACCTGCCGTC 490 ENSBTAT00000013158: Exon 1 114B7;147E14;190 N9; 329 H12;350E16
R: ATACCTGAGCCATGCTCTCG
S091 Loc785478 F: TACGCCACCTACACACACAC 439 Exon 65 L20;133 M1;211 N8; 233B22;233O14
R: GACTGGTAGCTCCTGATCTG
S092 GPR116 F: CACATCCAGTGCTTATTCAT 302 ENSBTAT00000035930: Exon 18 291 M9
R: TAGACAGAGAAGTTGGCTTG
S093 GPR110 F: AGTGGACAGATACCGGCTGC 452 ENSBTAT00000028795: Exon 10 None
R: AGGTGTGGCCATGTGATGGA
S094 TNFRSF21 F: CAGAGCAGAAGGCACCAAGT 500 ENSBTAT00000047874: Exon 11 118P16;351 H10
R: ATTGTCTGCCTCCTTGGTCC
S095 LOC785024 F: GGTTGTCAAGCCACTCGAAT 611 Exon 14B7;79 L8;168 N8; 264 L6
R: CGGAGTATATGGCCAGTGTT
S096 LOC512926 F: AGAGCAGAAGGCACCAAGTC 437 Exon 27A8;290 J19;351 H10
R: ACGCTCTGCATCTCATCACA
S097 CD2AP F: TACCACAACACCAACTGCAT 309 UniSTS:278169 1 H10;14A2;75 J19; 114B12;151 J21;166 L22
R: TTACCGGGATCACAGAAACA
S098 GPR115 F: CACAGTGGTGGCAGCAATAA 490 ENSBTAT00000003815: Exon 5 None
R: GAATAGAGTGCAATGCCGGT
S099 OPN5 F: CTACATCTGCCTGGCGGTCA 287 ENSBTAT00000021933: Exon 4 167I8;228 M7
R: CATGGCTGCTATGGATCCGA
S100 MGC148542 F: ACATTTTCTCCTTCTTTGGCTCC 272 UniSTS:133880 1A19;1B9;140A1; 216D18;319I16
R: GATAGAGGATGACGACAAATGGC
S101 Loc785693 F: AGCCAGGTAGAGTTCCAATG 518 Exon 17 K13;75E1;76B22; 103 F21
R: AGTCTCGGCAGTTACCTTGA
S102 MUT F: AGCAAAGCACATGCCAAAAT 750 UniSTS:279392 74 J7;8;86P12;252B10; 255 G2;266O16;313 L2
R: TTCCCCAGAAGAAAGACAAC
S103 Loc787783 F: GGAATCATCAACCCAGTGAGAAAGC 269 UniSTS:476844 255 G2;266O16;274D6; 288I23
R: CACACGGCGGCAGAAAGAGG
S104 RHAG F: GAATCGATGACCATCCATGC 470 ENSBTAT00000015012: Exon 4,5 53D7;173C22;186 L10; 226 G3;4;226 H7
R: AGAAGGCTGGAACATGCGTA
S105 Loc100138627 F: AATGAATAGTATCCCCAATACCTGC 150 UniSTS:164033 None
R: GTCCACAAAACATTCTCCTTTCC
S106 TFAP2D F: TAAGCTTTCGGAGAAACCCA 1422 UniSTS:482175 5 K4; 139 L18;230 K5
R: CAGCAGCAAGACTCTCTGGA
S107 TFAP2B F: TGCATGCTCCCTCCTCTC 120 UniSTS:71657 25D11;25 F24;142E22; 161A23;167 J23;189D14
R: CCTCGTCCAATTATGGTGCT
S108 Loc100138859 F: GGAGCACCACAGTACGTAAG 561 Exon None
R: GAGGTGTGCCTGTATTGCTA
S109 Loc537895 F: TTCTCTCAAATGATGAATATGCTTC 270 UniSTS:251053 56 J7;86O3;87 H23; 277 G10;277 H11
R: GGACTATTCTATGCATGCCTCTC
S110 IL17A F: CACTCAGGCTGTATCAATGC 591 ENSBTAT00000002786: Exon 3 13B24;74A7;74E17; 164 H22;164I23
R: CAGCTGTGTCATGTACTCCA
S111 MCM3 F: TGTCCCGATTTGACCTTCTC 515 UniSTS:268664 69 G8;168E20;223C7; 263 M23;270P6
R: GTCATCAGGGCTGAAGTTGG
S112 PAQR8 F: TCTATGTCCTGTCCTCCATC 447 ENSBTAT00000035844: Exon 2 102 M1;160 L10
R: AGAAGAAGTAGGCACTGACC
S113 TRAM2 F: TGTTCTACATCTTCATCGCCA 630 UniSTS:267311 13P23;53 J18;92C23
R: ACCAGATCACCGAGCTGAGA
S114 TMEM14A F: CTACCCAAGAAACACTGTCGC 286 ENSBTAT00000006857: Exon 6 2C18;31C1;139B24; 183A23;280 K17
R: AGAGCATTCTATGAAGCCCG
S115 ICK F: ACGGACTGGATCGCTAAGTA 627 ENSBTAT00000020711: Exon 14 2C18;76A8;77 G6; 198C12;199 K7
R: CAGAACAGCACAGCGGTATT
S116 GCM1 F: AGCTGTCCAACTGCCTCCTG 363 ENSBTAT00000010709: Exon 6 141A15;199 K7;230E24; 314I2
R: TGGGAAGGGGAGAAGTCGTA
S117 ELOVL5 F: CTACAGCCACGAGACAGTTT 182 UniSTS:279336 64 N21;82O21;90C20; 127 J19;163 F13
R: GGTTTCAATCATTCTTTCAT

* The bovine oligo primers were designed along the target bovine genomic sequence at an interval of ~80-160 kb between the two neighbor loci, depending on the availability of the DNA sequence that meet the primer selection criteria. A total of 119 pairs of primers were listed here.

Li et al.

Li et al. BMC Genomics 2012 13:398   doi:10.1186/1471-2164-13-398

Open Data