Table 5

Primers used throughout this study
Name Sequence
pNC1 ACGCGTCGACGCTGTTGAGGTTCCGGCTGTA
pNC2 GGGGTACCAATCTTCAGAGCGCGCCAG
pNC7 CCGCTCGAGGGATCTCAGAACAATATACCAG
pAOpyrG-GA5rev ACGCGTCGACCCGCTGTCGGATCAGGATTA
pNC8 ATAAGAATGCGGCCGCCTCCATACCACTTTGTGCTAG
pNC11 CCGCTCGAGGGCGCATGAGAGAGTTAGG
pNC31 CGTGACACAACATCCTCCAGCGGTGTTGTGCGACCTCCAGTGTCCGTCGCTGG
pNC32 CCAGCGACGGACACTGCAGGTCGCACAACACCGCTCCAGGATGTTGTGTCACG
phac1 CTTCTCCTACCCTAACTCCT
phac2 TCAAAGAGAGAGAGGGCA

Carvalho et al.

Carvalho et al. BMC Genomics 2012 13:350   doi:10.1186/1471-2164-13-350

Open Data