Table 3

Sequence-specific PCR markers linked to the anthracnose disease resistance Lanr1 of Lupinus angustifolius developed in this study
Marker Origin Primer pair Primer sequences (5’ to 3’)
AnSeq1 Candidate marker 3* AnSeq1F AATTCCACAAATTGAAAAAC
AnSeq1R GAAGTCAATTAATTAGTATTAGTAC
AnSeq2 Candidate marker 5 AnSeq2F CTTCTTCAGAAACAAGGAG
AnSeq2R CAGATTAATCTCTTTAGATTTTG
AnSeq3 Candidate marker 9 AnSeq3F GAATTCAGAGACAGGACTC
AnSeq3R AGTGTTTTTTTGGTTATCTAG
AnSeq4 Candidate marker 13 AnSeq4F GAATTCTGATGTGAAACAAC
AnSeq4R CTCCTGGCTGAGCTTTG
AnSeq5 Candidate marker 38 AnSeq5F GAATTCAGTGGAATATTTCAT
AnSeq5R CTTAGAACCATTCAGGTATG

*Candidate marker numbers were consistent to the candidate makers listed in Table 1 and Table 2.

Yang et al.

Yang et al. BMC Genomics 2012 13:318   doi:10.1186/1471-2164-13-318

Open Data