Table 3

Semi-quantitative and quantitative real-time PCR primers, and optimal conditions for semi-quantitative PCR
Gene symbol Primer name Primer Sequence Annealing Temperature (°C) MgCl2Concentration (mM)* Cycle Number
Cct3 Cct3 F GGATGCCTAAAATTAGCCTCCTA 62.5 1.5 30
Cct3 R GAAGCTACGGCAAATGATGG
Malat1§ Malat1 F GTACGCGGGCAGACTAACAC 57.1 1.5 36
Malat1 R TGCGTCTAGACACCACAACC
C16orf62 C16orf62 F CGGCCGAGGTACAAATTAAG 58.3 2.5 36
C16orf62 R TGCAAGTGCATTATGGAAGC
Mmp2 Mmp2 F ATGAAGAAGCCCCGCTGTGGTAATCC 62.5 4.5 27
Mmp2 R AAAGGCATCGTCTACTGTTTCGGAGTCC
Nf1a Nfib F AAACACACTGCGTCAAGTGC 61.4 1.5 24
Nfib R CTTGCCCTGGATAGCGATTA
Notch2 Notch2 F TATTTCTGTGGCTGCCTGGA 62.5 1.5 36
Notch2 R GGGACAGGGACCTTTGTTGT
Pp1§ Pp1 F ACCTCTTCCTGGGCGACTAT 62.5 1.5 27
Pp1 R TGATGTTGTAGCGCCTCTTG

*total concentration, including any MgCl2 in Taq buffer.

§Same primers used for qRT-PCR but at 60°C annealing temperature and 40 cycles.

Chojnowski and Braun

Chojnowski and Braun BMC Genomics 2012 13:308   doi:10.1186/1471-2164-13-308

Open Data