Table 2

CAPs markers conversion.

SNP-ID

Primer forward

Primer reverse

Reads ratio

Enzyme

Product size (bp)

Restriction site (bp)

"RomanescoC3" restriction produts

"Altilis 41" restriction products

Segregation pattern

Linkage groups


211-167

TCAACCCAATCTCGTCAGTG

CTTCATAGTGGCAGCCTGGT

10/30

EcoRV

372

162

372

372,

    210,162

Test cross

LG Alt_1a

4977-209

AAATCCCACATATGGAAATAGC

TCATGACACAAGGTGGAGACA

28/45

XmnI

360

176

360

360,

    176,184

Test cross

LG Alt_2

5548-175

AATGCACAAACCAAGTGCAA

TGAGCTCATTCGGAGGAAAT

5/17

XmnI

248

110

138,110

    248
,138,110

Test cross

New LG Alt_22

5983-127

TTGGTGGGTTTTAGACACCTTT

GTTAAACCCCCTGGATTGCT

3/5

TaqI

179

118

179

179,

    61,118

Test cross

LG Alt_1b

13671-168

TCTGGAGCATAAGAGGTAGGG

TTCAGTCGACTTCAAGGGAAC

13/20

FokI

243

88

243

243,

    155,88

Test cross

LG Alt_1a

14488-152

AAAGCTTTTTCCCCTTTCC

AAGTGCGTATTTGATTGATTGA

22/51

MseI

388

150

388

388,

    238,150

Test cross

LG Alt_6

14600-111

AAAAACACGCTCCTTCCATA

TGTCATCCCCATGAAAAAGC

7/12

BccI

290

97

290

290,

    193,97

Test cross

New doublet

20149-154

CCAGATGCAAATTGATACGTTG

GGATCTGCATTGAAACCTTGA

10/21

EcoRV

262

153

153,109

    264
,153,109

Test cross

LG Alt_1b

22767-99

CGGCACAACTAAGAGACAATCT

TTGGAGTATGTCTCGGGCTA

8/15

BccI

315

88

315

315,

    227,88

Test cross

LG Alt_18

25124-86

ACAAGGCCGGACCCTAAAC

TGGAACAGGAAGGACAGGTT

7/15

DraI

288

71

288

288,

    217,71

Test cross

LG Alt_9

25294-169

GAGGAAACTTTTCCCCATCG

CCGTTGTTGTATGCCTCAAA

4/11

XbaI

327

159

212,159

    327
,212,159

Test cross

LG Alt_4

25584-143

ATTCGCCATGGAACAAGG

GCAGTCTAATGCTTCAACTGGT

12/29

TaqI

272

89

183,89

    272
,183,79

Unclear

-

26480-171

CGACAAACTCCCTCCATGTT

TGTGGTATTGATGGGGAACC

3/6

EcoRV

320

153

320

320,

    172,153

Test cross

LG Alt_2

26420-81

ACATCAACGCCAGCAAAGAT

TTCTTGTTTGAATCTCAAGTGC

5/18

XmnI

281

76

205,76

    281
,205,76

Missing cut

-

36002-194

GCACAGGAAAATGTTGGTGTTA

GTCTTTGCAATTCCAATCAGA

5/16

DraI

369

152

217,152

    369
,217,152

Test cross

LG Alt_14

36199-225

TGACCAGGTTTCAGGTATGTG

AACGTACAAATTCAAAGCACGA

7/11

BamHI

398

221

221,177

    398
,221,177

Test cross

LG Alt_8

38377-214

AGAACCCGAAAACGTCTCCA

AGGACCTAATGCAGGTTCTGA

16/22

NdeI

451

203

451

451,

    248,203

Test cross

LG Alt_4

38382-111

CAGGGAGAATCCCTCTCTCA

CATATATTGGATGATCCCTTGG

4/9

DraI

305

99

206,99

    305
,206,99

Unclear

-

40917-80

TGCTTCCCAATAGCCTCTAA

TGTGGTGATTTTGGACGTGT

7/13

FokI

306

70

306

306,

    236,7

Test cross

LG Alt_1a

43124-62

TGATTATGCATCACCCCAAA

CACTTTTAATCCCAAAACAACC

9/19

TaqI

309

52

257,52

    309
,257,52

Test cross

LG Alt_4

43867-147

TGCATTTCTTCCTTGTGGTTC

ATGCTCCGTGAGGTTCGTAG

10/19

EcoRV

314

138

176,138

    316
,176,138

Unclear

-

45558-111

GGGAGAAGACCACGTAATTTGA

GTTTATTTCCGTCCCCAGGT

10/19

FokI

294

122

172,122

    294
,172,122

Test cross

LG Alt_5

45893-190

TCATTGGTCTTGCAGTTGGA

ACTTGGGCTGTAGCTTGACG

8/13

TaqI

344

176

176,168

    344
,176,168

Test cross

LG Alt_18

45900-239

GGACAGTTTTGAGAAATGGTCT

TCACACGGTTTTGCAATCTC

2/6

EcoRV

306

203

306

306,

    203,103

Missing cut

-


CAPs markers conversion of 24 RAD loci randomly selected among CcRAD2. SNP-ID identifies the RAD contig name and the original SNP position, respectively separated by "-". Reads ratio refers to the number of occurrence of a nucleotide differing from the consensus sequence. Bands present only in the "Altilis 41" parental line are underlined. Linkage groups are reported according to the reference map of cultivated cardoon [12].

Scaglione et al. BMC Genomics 2012 13:3   doi:10.1186/1471-2164-13-3

Open Data