Table 1

Predicted novel miRNAs
Name Sequence Length Abundance Chromosome Location
Can_miR_01 ACGGAAAAUCAUGGCUGCACUUAA 24 26 1 Intergenic
Can_miR_02 AAUCAAGUUAGGAACCAUGCAAGU 24 2 6 3′UTR
Can_miR_03 ACUCUAUAUGAACUAAGAUCG 21 6 8 Intergenic
Can_miR_04 UUGGCUGCAUCCCGUUCUCCUC 22 7 4 Intergenic
Can_miR_05 AGCUGCCGACUCAUUCACCCA 21 30 1 Intergenic
Can_miR_06 UCUCUCUCUCCCUUGAAGGCU 21 3 11 Intergenic
Can_miR_07 AUGAAUGUAGGUAAUGCUAGAAAG 24 3 1 Intergenic
Can_miR_08 GAAUGAUCAAAGUUGGACACGAA 23 8 1 Intron
Can_miR_09 ACCUCAACAUGGUAUCAGAACUGG 24 8 7 Intron
Can_miR_10 UCAAUAGCGAUCAAGGCGGAC 21 3 7 Intergenic
Can_miR_11 UGGGAAAGGACCAUAAUACCCCUA 24 7 3 Intron

Lan et al.

Lan et al. BMC Genomics 2012 13:264   doi:10.1186/1471-2164-13-264

Open Data