Table 1

List of CAPS markers polymorphic between Arabidopsis ecotypes Col-0 and Nd-0

CAPS marker

Restriction enzyme

Primer Sequence


1H1L-1.6

RsaI, Tsp509I

F:CTAGAGCTTGAAAGTTGATG

R:TTGAGTCCTTCTTGTCTG

20B4L-1.6

DdeI

F:CTAAGATGGGAATGTTGG

R:GAACTCATTGTATGGACC

40E1T7

AccI

F:GGTCCACTTTGATTCAAGAT

R:GCAAGCGATAGAACATAACG

AF2

DdeI

F:TCGTCGTTTTTGTTTCCTTTTTCTTA

R:CCATTCATTTAGGCCCCGACTTTC

B9-1.8

TaqI

F:CATCTGCAACATCTTCCCCAG

R:CGTATCCGCATTTCTTCACTGC

CAT2

TaqI, Tsp509I

F:GACCAGTAAGAGATCCAGATACTGCG

R:CACAGTCATGCGACTCAAGACTTG

ER

DdeI

F:GAGTTTATTCTGTGCCAAGTCCCTG

R:CTAATGTAGTGATCTGCGAGGTAATC

G4711

DdeI

F:CCTGTGAAAAACGACGTGCAGTTTC

R:ACCAAATCTTCGTGGGGCTCAGCAG

GPA1.4

Tsp509I

F:ATTCCTTGGTCTCCATCATC

R:GGGATTTGATGAAGGAGAAC

JM411

DdeI

F:GCGAACCACTAAGAACTA

R:CTCGACTTTGCCAAGGAT

LFY3

RsaI

F:GACGGCGTCTAGAAGATTC

R:TAACTTATCGGGCTTCTGC

MI342

Tsp509I

F:GAAGTACAGCGGCTCAAAAAGAAG

R:TTGCTGCCATGTAATACCTAAGTG

M555

AccI

F:CCTTTAATTAGTTATCAAATC

R:CTCTTGAATTATTAAGTTGACTAG

M59

RsaI, Tsp509I

F:GTGCATGATATTGATGTACGC

R:GAATGACATGAACACTTACACC

MBK23A

TaqI

F:GATGATTAGGCGCAAAATTGAG

R:ATTACCAGCCTGGCTTCAGG

PAI1.1

TaqI, RsaI, Tsp509I

F:GATCCTAAGGTATTGATATGATG

R:GGTACAATTGATCTTCACTATAG

T20D161

TaqI, RsaI, Tsp509I

F:CGTATTTGCTGATTCATGAGC

R:ATGGTTTACACTTGACAGAGC

T6P5-4.8

RsaI

F:TGAAAGACACCTGGGATAGGC

R:CCAACTTTCGGGTCGGTTCC


Restriction endonucleases used for generating individual CAPS markers are shown. F, forward primer; R, reverse primer.

Sahu et al. BMC Genomics 2012 13:20   doi:10.1186/1471-2164-13-20

Open Data