Table 3

Primers and RT-PCR conditions used to amplify tammar IFITMs
Gene Forward Reverse Number of PCR cycles Annealing temperature
IFITMA1 GTGCTCTGCGCTCCCTGT AGCCATTCCCCAACAAATA 35 58*
IFITMA2 GGCTCGCAGTGCTACAGTCT AAGTGAAGAGAGGCCACACC 30 60*
IFITMB AGGAGCGCTATCCTGTGTGT CTAGGGAAGCATGCAGGTGT 35 59*
IFITM10 CCTTCAGCAGCCTCCTCAG AGTTCAGGTCAGTGGGATGG 40 58*
IFITM5 GACCTATGCGGCGAGTCCGC GAAAGGAAGGAGGGCATCTT 40 58*
GAPDH CCTACTCCCAATGTATCTGTTGTGG GGTGGAACTCCTTTTTTGACTGG 30 60

Asterisks indicate that a hot start PCR was required.

Hickford et al.

Hickford et al. BMC Genomics 2012 13:155   doi:10.1186/1471-2164-13-155

Open Data