Table 2

Counts of the 21-24 nucleotides non-conserved miRNAs isolated from secondary xylem tissues of Am54 and Am48 and their potential targets predicted to be involved in lignin biosynthetic pathway.

Sequence ID

Sequences

(5’ ➙ 3’)

Counts Am54

Counts Am48

Target genes


15212(24)

AGAUGGUGAGGGAUCCAGGACUAU

17

18

Populus trichocarpa F-box family protein

13039(24)

UGGACGUACUGAACAACAAUGAAG

25

20

Populus trichocarpa F-box family protein

278(21)

UAAUCUGCAUCCUGAGGUAUA

281

286

Populus trichocarpa F-box

1045(24)

GAGGACCGAGAUCAUAGAUGAAGA

121

104

Arabidopsis thaliana peroxidase, putative

666(21)

UUCAUUGUCUGUUCGGCCCUG

67

121

Zea mays typical P-type R2R3 Myb protein

1391(21)

UUUGGCAUUCUGUCCACCUCC

522

57

Populus trichocarpa f-box family protein, mRNA

2100(21)

AAACGGGGUUGUGGGAGAGCA

15

36

Populus EST from mild drought-stressed leaves

2511(21)

GAGCUCAUCUUAGGACACCUG

46

29

Populus EST from mild drought-stressed leaves

3079(211)

AAGGUCGGCCAGUGAGACGAU

16

23

Populus EST from mild drought-stressed leaves

4169(21)

GACUACAAUUCGGACGCCGGG

22

16

Populus EST from mild drought-stressed leaves

5876(21)

ACGAUACUGUAGGGGAGGUCC

13

10

Populus EST from mild drought-stressed leaves

6077(21)

AGCGUAGAUCCGGAGAUUCCC

16

10

Populus EST from mild drought-stressed leaves

166(22)

GCCGGCCGGGGGAGGGACUGGG

150

127

Populus EST from mild drought-stressed leaves

297(22)

GCCGUCCGGGGGACGGACUGGG

194

72

Populus EST from mild drought-stressed leaves

1182(22)

GCCGGCCGGGGGACGGACUGCG

104

20

Populus EST from mild drought-stressed leaves

80(23)

GAUGGAACAAUGUAGGCAAGGGA

89

158

Populus EST from mild drought-stressed leaves


Ong and Wickneswari BMC Genomics 2011 12(Suppl 3):S13   doi:10.1186/1471-2164-12-S3-S13

Open Data