Table 1

Primer sequences used in quantitative qRT-PCR analyses

Gene name

Gene symbol

Sense primer

(5'-3')

Antisense primer

(5'-3')


3-hydroxy-3-methylglutaryl-Coenzyme A reductase

Hmgcr1

cttgtggaatgccttgtgattg

agccgaagcagcacatgat

Low density lipoprotein receptor

Ldlr1

aggctgtgggctccatagg

tgcggtccagggtcatct

Insulin induced gene 1

Insig1 2

tcacagtgactgagcttcagca

tcatcttcatcacacccaggac

Peroxisome proliferator activated receptor α

Ppara 3

cctcttcccaaagctccttca

cgtcggactcggtcttcttg

Deiodinase iodothyronine type II

Dio24

Mm00515664_m1

Interleukin-6

Il64

Mm00446190_m1

Glucose-6 phosphatase

G6Pc4

Mm00839363_m1

18 S ribosomal RNA

18S5

cgccgctagaggtgaaattc

ttggcaaatgctttcgctc

β-actin

Actb

ccgtgaaaagatgacccagatc

cacagcctggatggctacgt


1 Reference [41]; 2 Reference [42]; 3 Reference [43] ; 4 Assay-on-demand (Applied Biosystems) 5 Reference [44]

Simončič et al. BMC Genomics 2011 12:96   doi:10.1186/1471-2164-12-96

Open Data