Table 1

Sequences of oligonucleotides used in this study

Purpose

Oligonucleotide

Sequence


phlp1

PHD2DEL5F

5' ATGCGGCCGCTGCTCGTAAAGAGGTGCAG 3'


5' region

PHD2DEL5R

5' ATACTAGTGCTGAGCGCTGTTATATAGATG 3'


phlp1

PHD2DEL3F

5' ATCTCGAGCAATGATTTGCACAACTC 3'


3' region

PHD2DEL3R

5' ATGGTACCGCTAGCAGCATCAACACCTCTCTAC 3'


gnb1

DELgnb15F

5' ATACTAGTCCAGGTATCAAGGCTCTCATC 3'


5' region

DELgnb15R

5' ATGATATCGGGAGAAGACGATGGAGATG 3'


gnb1

DELgnb13F

5' ATCTCGAGTCATCACCATCCGCATTC 3'


3' region

DELgnb13R

5' ATGGTACCCAGACTTTGACATGCCAATG 3'


gng1

gng1DEL5F

5' ATACTAGTCCACTGCTAATTATCCGC 3'


5' region

gng1DEL5R

5' ATCCCGGGCGGAGGGTGAATTAAAGG 3'


gng1

gng1DEL3F

5' ATCTCGAGATCGATGATGAAGGAGCTACTG 3'


3' region

gng1DEL3R

5' ATGGTACCTGGCATGAGCTTTCAACTTC 3'


phlp1

PHD2cDNAF

5' TATATAACAGCGCTCAGC 3'


cDNA

PHD2cDNAR

5' AGAATGCTTTAAGAGTTGTG 3'


gnb1

gnb1cDNA1F

5' ATACTAGTTCGCCCGCCTCCCATCTC 3'


cDNA

gnb1cDNA1R

5' ATAGGCCTAGATATGCGTAGTCGGGTGTCC 3'


gng1

gng1cDNA1F

5' ATGTCGACGCATCAGTTCCAACTCGAC 3'


cDNA

gng1cDNA1R

5' ATAGGCCTAAATCAAAGCGATCCCAC 3'


cbh1

RTcbh1F

5' ACCGTTGTCACCCAGTTCG 3'


qRT-PCR

RTcbh1R

5' ATCGTTGAGCTCGTTGCCAG 3'


phlp1

RTphd2F

5' GACAGGAGCTCGAGAAGGAAG 3'


qRT-PCR

RTphd2R

5' CAAAGACGGCAACGGTAGTG 3'


gnb1

RTgnb1F

5' CATCAACGACCGAAGCATC 3'


qRT-PCR

RTgnb1R

5' GCAGGCACCAGAAATGAAG 3'


gng1

RTgng1F

5' CGTACTGCAATGGCACAAGAG 3'


qRT-PCR

RTgng1R

5' GGATTGCTGAGGCGCATAG 3'


rpl6e

RTL6eF1

5' GATACGTCATCGCCACCTCC 3'


qRT-PCR

RTL6eR1

5' CTTCTCCTTGGCCTTCTCG 3'


cbh2 Terminator

cbh2T_F1

5' GGCTTGCTCGCTGACTGATAC 3'


qRT-PCR

cbh2T_R1

5' GAGGGAGACGAGGTTGTGATG 3'


hph

HPH_F1

5' GATGTAGGAGGGCGTGGATATG 3'


qRT-PCR

HPH_R1

5' GGGAGATGCAATAGGTCAGG 3'


Tisch et al. BMC Genomics 2011 12:613   doi:10.1186/1471-2164-12-613

Open Data