Table 3

Real time PCR primers used for expression validations of selected enzymes.

Accession

Enzyme

5'-Forward Primer Sequence-3'

5'-Reverse Primer Sequence-3'


EFI_002990

AACT-1

ACTATGCTTGCAGCCCAAAG

ATTTCCCATGCCAACATCAT

EFI_012483

AACT-2

ACAATGCTTGCTGCACAGAC

TCTCCACAAACTCCCATTCC

EFI_015339

CS-1

GGAGAGCTATTTTTGGGCAGT

CGACTTGAGCAAATGAGTCGT

EFI_018002

CS-2

GCAATTGATCCATCAGCAAG

AAGCAAAACAACTCTGGCAAT

EFI_007143

DXS-1

CGCACTAAATTTTGGGTTGC

CAAATCCCTTGGAATTGGTG

EFI_010574

DXS-2

GCTGCAAAAAGCATCACAAA

GGAGCTGGCATTGCTTTTAC

EFI_003135

DXS-3

TTTGCAACAAGTGGCATCTC

ATAGCCAAAGCCTCCACAAA

EFI_010535

GGPPS-1

CAAAAAGCTTCGCAATTCCT

GATTTTTGCGGGTTCTCTGA

EFI_010585

GGPPS-2

ACTTGCAGCCGTTTGTTTCT

ATCAGCAACGAGGGAAAATG

EFI_008533

GGPPS-3

ATTGTTAGCGGGTGCTGAAG

CAGCTCTTCCGCCATTTCTA

EFI_016937

GGPPS

TCAATTCGCTGTTCTGCTTC

CCCTTAGAAAGGGCGGAGTA

EFI_001905

IDS/HDR

CCACAGACGACTCTGCTTCA

GGTGTGCTCATTCCCATTTT

EFI_000087

HDS

GTTTGGGCGATACAATCAGG

ATCCACCTCTTCACCCTCCT

EFI_0 00846

HMGR-1

CTCCACCGCAAAACCTCTTA

AACGACATGGAGAGGAGTGG

EFI_011656

HMGR-2

CAGTGCTGTGAAATGCCTGT

AGCTCTTGTCATGCCATCCT

EFI_001179

MDD

GAGACATGGGTGAGGATGGT

CCTCCCCATTAAGCCACATA

EFI_014705

Actin-1

GGGAACGAGTCCCTGGTAGT

CTGCGTTGGTGGTCTTACCT

EFI_006680

Actin-2

AAATATGGCCGACAGTGAGG

ATACCTCGCTTGGACTGAGC

EFI_000139

α-tubulin

GGCAACTTTTCCATCCTGAG

TCCAAGACCAGAACCAGTCC

EFI_014153

β-tubulin-1

AAGCAGGTCAATGTGGGAAC

CATTGTCCCTGGTTCAAGGT

EFI_014578

β-tubulin-2

GCTTGCAAGGTTTCCAGGTA

TTTTCCACAAGCTGATGCAC


Barrero et al. BMC Genomics 2011 12:600   doi:10.1186/1471-2164-12-600

Open Data