Table 5

Primers used in this study.

Name

Sequence of primers (5'→3')


Cystatin-PF

GTGATGAGGTAAAGCCCAGTGCGGAG

Cystatin-PR

TGGCAGTGGTTTGAAAACACGGAGGT

CCL18-PF

TGCTTTCCTCAGTGATCTGCCAG

CCL18-PR

AGATGCGACGACCCTTTTTTGAA

CCR4-PF

ACAACAGCCAAGCCACAGGAAGC

CCR4-PR

CAGGTGAAAAAACAAACAATGAA

IL8-PF

GTGTCAACCCAGTGCTGTATGCCTT

IL8-PR

TTCAAAGTGTCTCTCTGGTCGTCTC

IIGP1-PF

ACCACCTTAGAGGCTACACCATACCCC

IIGP1-PR

TCTCCTGAGCGAGTTTCACATCATTTT

GILT-PF

TGTTCCTAACTGAGATGCTCTTCCCC

GILT-PR

ATGTTGCCCTGACATTCTGGTGGTC

g-lysozyme-PF

CCTATAATACCTACGGGCTGATG

g-lysozyme-PR

TAGGCTGCTATCCCACCTTTCA

TFIID-PF

CCAGGAGGATGAGGAGGAGGAG

TFIID-PR

GCTGTATGGAGGAGAAAGGGTT


Huang et al. BMC Genomics 2011 12:556   doi:10.1186/1471-2164-12-556

Open Data