Table 3

List of primers used in qRT-PCR analysis

Unigene

Forward primers (5'-3')

Reverse primers (5'-3')


Ta.23798

GACCGTTCACAACACCC

TATTTAGCAGATAGCACCAC

Ta.63039

CGAACGCCCTCATGTGTTT

CATTGGTTGATGATTGGGATTG

Ta.19

GGAGCAGGTGCAAGTAGAGG

CGTTTGGTTCATCGGAGC

Ta.4334

CTGTGCAGAATATAACATGGAGG

CAAGGTCACATTCAGACTGGTTTC

Ta.10140

CCATTCCTCGCTAGGCTGA

GTACTGGTTGTCGAACACGTTG

Ta.118

CAAGCGTTTGTGGAAGTGAAC

CAAGGAAGAGGAAAGGGTGAT

Ta.35848

TCGGCTTCATTTACTGCGT

ACTCCGTGACTGGCTTTGG

Ta.41965

GCAACATCGTAACTGCCAACA

GCACCAAAACACACTGACAACA

Ta.54446

GGTGTACCCACTCTTCATCTTGG

CGGCGAGGTTCCTTGACTAC

Ta.7721

GCTGCAACTTCTGCAACACA

CCCCTCAAGTTCACCGACA

Ta.23679

ATACCACCCACAACCGAGATG

CCACCCCTACAAATGACCG

Ta.54227

CAAATACGCCATCAGGGAGAACATC

CGCTGCCGAAACCACGAGAC

Ta.2291

GCTCTCCAACAACATTGCCAAC

GCTTCTGCCTGTCACATACGC


Two transcripts (Ta.54227 and Ta.2291) were chosen as internal controls for data normalization.

Yang et al. BMC Genomics 2011 12:513   doi:10.1186/1471-2164-12-513

Open Data