Table 5

miRNA targets identified in melon transcripts for potential ta-siRNAs derived from unigene c15d_05-D02-M13R_c

Melon sRNA name

sRNA sequence

Targeted unigene

Unigene sense

Score (miRanda)

Unigene annotation


a11_156739_

AGTTTGCTTCTTGGGCTCTTC

cA_05-B09-M13R_c

Forward

175

IAA16; transcription factor

a11_156739_

AGTTTGCTTCTTGGGCTCTTC

cPS_07-G03-M13R_c

Forward

175

IAA16; transcription factor

a14_55988_

AGAGCCCAAGAAGCAAACTGG

cCL678Contig1

Forward

172

auxin efflux carrier family protein

a24_92242_

AGAGCCCAAGAAGCAAACTG

cCL678Contig1

Forward

172

auxin efflux carrier family protein

a33_151240_

CAGTTTGCTTCTTGGGCTCTT

c15d_39-H01-M13R_c

Forward

171

ARF6 (AUXIN RESPONSE FACTOR 6); transcription factor

a14_362833_

CGATGGTGATGGGATTTTTGA

cCL1479Contig1

Reverse

171

IAA9 (INDOLE-3-ACETIC ACID INDUCIBLE 9); transcription factor

a14_362833_

CGATGGTGATGGGATTTTTGA

cCL4756Contig1

Reverse

175

ATAUX2-11 (AUXIN INDUCIBLE 2-11); DNA binding/transcription factor

a14_362833_

CGATGGTGATGGGATTTTTGA

cP5.72_c

Reverse

175

IAA7 (INDOLE-3-ACETIC ACID 7); transcription factor

a33_203464_

CATTTTTTACGATGGTGATGG

cCL3310Contig1

Forward

179

ATUBP3 (ARABIDOPSIS THALIANA UBIQUITIN-SPECIFIC PROTEASE 3)

a14_362833_

CGATGGTGATGGGATTTTTGA

cCL3310Contig1

Forward

175

ATUBP3 (ARABIDOPSIS THALIANA UBIQUITIN-SPECIFIC PROTEASE 3)

a14_20904_

TACGATGGTGATGGGATTTTT

cCL4210Contig1

Forward

174

ubiquitin-associated (UBA)/TS-N domain-containing protein

a11_156739_

AGTTTGCTTCTTGGGCTCTTC

cCL1290Contig1

Forward

171

binding/ubiquitin-protein ligase


Gonzalez-Ibeas et al. BMC Genomics 2011 12:393   doi:10.1186/1471-2164-12-393

Open Data