Table 3

Potential novel melon specific miRNAs

Melon sRNA namea

nt

sRNA sequence

Number of sequences

Hits in genome

miRanda scoreb

Potential precursor lenght (nt)

MFEIc


a34_130677_

21

AUAGAUAUUGAUAUGCUUUUA

1

4

163

94

-1.0573

a24_2602_

21

UGCUACAUGGUUUAUCAGUGA

2

5

115

72

-1.2524

a24_177791_

21

UCGCAGAAGAGAUGGCGCCGA

7

1

143

91

-0.8587

a23_118111_

21

CAUUGAUAGACACUAAUAGAA

1

5

167

90

-1.475

a33_14294_

21

AUAGACUUCUAUUGGUGUCUA

1

1

154

74

-1.5105

a32_31625_

21

GUUCCCACGGUAAUGAUAAUA

2

1

127

72

-1.1045

a32_1324_

21

AGGUGUCAUCUUGCUGCGAUA

1

1

179

99

-1.2

a22_190223_

21

UGUUAUGCAUGGCGUCGGGAG

1

5

187

157

-1.2915

a14_98657_

21

AUAGCGAAGUAUAUCAGUGAU

1

1

154

127

-1.2423

a14_51701_

21

UGAGCCGUGCCAAUAUCGACG

1

1

159

97

-1.1

a14_180374_

21

UAAAUAUUUAGAAAGUCAAUC

1

4

159

79

-1.855

a21_80766_f

21

UAAUAUUCAUUUUCACUUCUU

1

1

116

232

-1.2494

a21_78863_

21

UGCAUCCUGAGGUUUAGGGAG

3

1

159

194

-0.9776

a21_244426_

21

AGUAACCACUAAGCUAAUGGC

1

1

187

597

-1.0096

a23_1441_f

21

UAUAGCAAAGUCUAUCGAUGG

5d

1

107

77

-1.1435

a13_84447_e

21

GGUCAUUCUAGCAGCUUCAAU

13d

1

139

201

-0.96

a23_370_e

21

UGGUGUGCAUGUGAUGGAAUA

13d

1

163

113

-0.9061

a21_134553_f

21

GUUAUACGAGUUGGGUUGGGU

1

1

155

114

-0.9571

a11_95657_e

21

UUGUGUCAUUGACAUUGUGGU

1

2

195

191

-1.1708

a14_9427_

21

UCGUCCUGAGAAUACAUGUCA

35d

1

159

97

-0.9409

a14_668_

21

UGAGUUAUCGGUGAAUUCAAG

5d

3

159

516

-0.9675

a13_252112_

21

ACUGCUGCUUGUACUAUUGAA

1

1

191

255

-1.9670

a11_33177_

21

UUUAGUUUAGCCUAUUGCUUU

1

3

187

139

-1.1035

a11_191362_e

21

UUCUAUUGUCUUCAUUUGUGA

1

1

191

119

-1.2718

a34_224062_

21

UGAAAUGACUUGUCAAGUGCU

1

1

151

97

-0.975

a13_228150_

21

CUUGUACUUGAUUUUGUUGCC

1

1

191

115

-1.4469

a12_32299_e

21

AAUUUGUUGGUCAAAUGAUUG

2

1

195

107

-1.7552

a12_272161_

21

UUGUAUGGUGGAAAGAUGGAA

1

1

162

96

-1.4167

a11_33986_

21

GCUGACUUGCUGAUUGAGUUA

2

3

179

189

-1.4852

a13_33760_

21

UGAAUUAUCUGCUUAAGUUUU

1

1

187

95

-1.2889

a11_389198_

21

ACACGCAGAAGAGACGAUUGA

1

1

191

120

-1.5575

a13_357842_

21

UGGAGCAAUAUUGAUGCAUAU

1

1

195

220

-0.9548

a11_364692_

21

UUGGGUCUAUUUAAUGGGAGC

1

1

155

107

-1.2308

a13_281334_

21

ACUUUCUGUCAAUAUAAUCAG

1

1

175

115

-1.3943

a12_71107_

21

UAUCAUAGUUGGUGGUUCAGG

3

1

143

115

-1.2167

a13_120551_

21

UCAACGAUAGACAUUGAUAGA

1

1

171

107

-1.2875

a12_123886_

21

UUAUCAUUGAUAGACUAGUAU

1

2

155

174

-1.0612

a11_227522_

21

CAAGCCCAUGACAAAGCAAGC

1

1

187

225

-1.0929

a14_133932_f

21

UCAACACGAUCGUCUAGCAUG

1

2

173

113

-1.2295

a11_203340_

21

UUUGAGUGUCCUACUCACCUC

1

1

191

411

-1.0833

a11_11135_

21

UAGUGCCGCGCUGCGUGCGUC

85

1

147

102

-0.98

a11_31022_

21

UUUCGCUUUUCCUCUUUCGUG

1

1

191

454

-1.1523

a12_144938_

21

UCGUGGAUAUUGCUCUUUUCU

2

1

171

504

-1.3303

a33_181157_

22

GAUAGAUACUAAUAUGCUUCUA

1

2

188

87

-1.3227

a33_37151_

22

AGAUUAAUUUAUUGGGCGUUAU

1

2

144

94

-1.3313

a12_72169_

22

UUGAGCUAUGCUCAGGUUGACA

30

1

176

174

-1.2933

a24_96796_e

22

UGAGCUAUGCUCGCUUUGGCAA

21d

1

175

169

-1.2855

a11_378153_

22

GAGUUCCUAAGUUUUGAUGAAU

1

1

144

351

-1.2221

a11_378297_

22

UUUUGGAUUCUAUCGAUGAAAG

1

1

155

123

-1.4857

a23_244052_e

22

GGGCAGCCCCACGUUGGGCAUG

5d

1

175

353

-0.9263

a11_85662_

22

AAAUAUAUCGGUGUCUAUCAAU

1

2

132

85

-1.2208

a21_388555_

22

GAUAGACGCUGAUAGAUAGACA

3

1

124

76

-0.8963

a11_84237_

22

CGGCCAAAAAUGACUUGCCCGG

2

1

150

105

-0.8902

a23_124460_

22

AGGUGAGUUCUUUUUAUAGGCU

1

1

184

179

-1.6306

a23_163065_

22

AUUUGAUUAGCCAAAUUUAAAC

2

2

148

130

-1.0514

a23_71826_

22

CAAUAGUCAGAUGUAAACGAUC

1

1

180

228

-1.4282

a22_52587_

22

AAAAUUAUUGGGUGAAUUAGUU

2

1

179

162

-0.9013

a13_234225_

22

UGAAUUUUGUUAUGUUUUGUAA

1

2

168

80

-2.0417

a13_286453_

22

AGUCUAUCACCGAUAGAAGCCU

1

6

182

430

-1.4372

a21_339397_

22

CGCGAGGUUCUUUGUUUGUCUU

1

1

192

413

-1.3341

a14_283014_

22

UACCUAGUGAUGCCAUUGUCAA

1

1

184

533

-1.2829

a21_170878_

22

CUAAGGUUGCCCAGAGAUGUUC

1

1

163

271

-1.2341

a21_63125_f

22

GAAUAAUUAUCAAGUGUGUAGC

1

1

165

210

-1.7804

a11_146182_

24

UUAAAAUGUUGCUAUAUAAUUAAU

1

6

202

390

-1.6207

a21_169735_

24

UAUACGGGCCGUAAAUAGUUUGAU

2

6

132

369

-0.8885

a23_3672_

24

UUGCUCAUUGCUAACUGCAAAGAG

1

3

198

183

-1.7594

a14_260703_f

24

UUAAAAGUAUGAGACGAAAAUGAA

1

1

190

111

-1.4204

a14_218837_

24

UUAAAAAGAACUACACGAACGUGC

1

1

194

342

-1.1314

a14_148530_f

24

AAAUAGCGUCGGGGAAAGGUGUCU

3

1

152

73

-1.0167

a21_127379_

24

UGGGACAAAAGAAAACUGUGGGUC

2

1

162

586

-1.32

a11_2899_

24

AUGAUGCUUUGGUGCUAAGGAGGU

1

1

198

470

-1.6094

a11_248538_

24

AUUUUUGGCAUUUUACACGGUGAG

2

2

192

218

-1.5206

a13_59670_

24

AGUGGAGUGGGCUAUUUUAGUCCA

6

1

166

570

-1.1249

a32_72333_

24

AACUAUUUUAUUGGAACAUGUUGA

3

1

170

96

-1.0391

a33_22103_

24

AGUAUGAUCUCGGGCUAAGGUUGC

1

4

202

246

-1.4138

a24_224684_

24

AACAAAACGAAUGAUCAAAAUGGU

3

1

134

80

-0.8871

a13_225824_

24

ACCAAAUGGAUCUAUUCUUAUAAU

1

1

198

311

-1.3393

a24_82972_

24

AACGAUCGGGUUGACUACGUAAAU

3

1

190

146

-0.9354

a21_98074_

24

AAUUUUUAGUGGUCCCGAAAUGCA

3

1

166

112

-0.9033

a11_350684_

24

UGAGUGUAUCAUCGAGAUAGUGCG

1

1

190

307

-1.1642

a21_216237_

24

AAAUUUCAGGGUCUAAAUUGAUGC

2

1

138

447

-1.2096

a33_49599_

24

CAGCGUGAUUGAUGGGGCAUUUUU

3

1

118

287

-1.4678

a33_58155_

24

AUGGUCGAUCUCAACCGAGAUUGA

1

1

194

298

-1.3188

a23_103110_

24

CGUGAAGAUUGUGGAUAUUGGAGA

1

1

190

414

-1.5507


a Precursor secondary structures of sRNAs in bold are represented in Figure 4.

b miRanda score calculated for the identification of the complementary region to the putative miRNA.

c MFEI index calculated as described [35].

d Include cases where sequence variants with up to two mismatches were identified and counted

e Indicates miRNAs for which a miRNA* sequence was identified.

f Indicates miRNAs for which an asymmetric bulge of more than 2 bases was identified in the miRNA/miRNA* duplex of the precursor, not meeting exactly the structural criteria previously set forth [36,37].

Gonzalez-Ibeas et al. BMC Genomics 2011 12:393   doi:10.1186/1471-2164-12-393

Open Data