Table 1

Documented leaderless genes in S. coelicolor A3(2)

Gene name

Sequence upstream of TIS1

Probability2

Ref.


absA

CGCTCTTG

    TAGCGT
GCTGGAATG

0.95

[52]

devA

CGAAGTTGTAGCGTTTGGTCGTG

0.93

[53]

fabD

CCTCAAGAGAGAGTGTGAGAGTG

0.51

[54]

furA

CAGGGAG

    TAGGTT
CGCCGCCATG

0.80

[55]

KbpA

GACGCGGT

    TACTTT
GACGGCATG

0.93

[56]

malR

GACAGG

    TACAGT
CCACCCCTGTG

0.63

[57]

phoRP

GCCGTGCC

    TAACCT
GGAGACATG

0.91

[58]

vanH

GAGGCGCCTTGAATAGAGGCATG

0.27

[59]

vanK

CCGCCGCCTTGACTGGGGGCATG

0.78

[59]

vanR

CGACTCGTAATCTCGACACCATG

0.85

[59]

ptsH

CACCTGAAGGGCAGCATCACATG

0.00

[20]

sigJ

GCCTC

    GGGTAG
AAAATCCACATG

0.03

[21]

whiH

TCGGC

    GCCGACAA
AGGATGCGTG

0.09

[19]


1The last three characters are triplet for start codons, experimentally determined TSSs are bold, and the most-likely Pribnow boxs are italic. The -10 promoters proposed in literature, if available, are underlined.

2The probability that a gene is a leaderless gene regulated by σ70 was calculated by Eq. 5.

Zheng et al. BMC Genomics 2011 12:361   doi:10.1186/1471-2164-12-361

Open Data