Table 2

List of new predicted MIR genes in the sorghum genome

MIR gene ID

Position

Strand

miRNA size

miRNA sequence 5'-3'

miRNA* sequence 5'-3'

miRNA* size


sbi-MIR5381

Ch1: 574388..574497

+

19

AAGATCTGTGGCGCCGAGC

TCGGCGCTAAGATCTCTGG

19

sbi-MIR5382

Ch2: 1930828..1930937

+

18

CCAATCTAAACAGGCCCT

GACCTGTTTAGATTGGGA

18

sbi-MIR5383

Ch4: 43242765..43242874

+

24

ATGACAGAGCTCCGGCAGAGATAT

TTCTCCGCCGAGCTTATCTGTGG

23

sbi-MIR5384

Ch4: 45785396..45785505

+

18

CGCGCCGCCGTCCAGCGG

CTTGGCCGGTGCACGCGTC

19

sbi-MIR5385

Ch6: 56307517..56307626

+

22

ACCACCAACCCCACCGCTTCTC

GAAGCGGTGGTGTTGGTGGTGA

22

sbi-MIR5386

Ch7: 877244..877353

+

20

CGTCGCTGTCGCGCGCGCTG

GGTCAGGGCAGAGCACGCA

19

sbi-MIR5387

Ch7: 15969322..15969431

+

25

TAACACGAACCGGTGCTAAAGGATC

CCCTTTAGCACCGGTTCGTGTTACA

25

sbi-MIR5388

Ch8: 1629110..1629219

+

22

ATCTTTGCCGGGTGTCTCTGAC

CAGCAAACATTCGGCAAAGAAAA

23

sbi-MIR5389

Ch8: 4848342..4848451

+

21

GCTTGAGTTTATCAGCCGAGT

ATGGCTTATCAGCCAAGTGA

20


*All the small RNA reads mapped to "chromosome_7_22.BC_03" were derived from the predicted miRNA* strand

Calviño et al. BMC Genomics 2011 12:356   doi:10.1186/1471-2164-12-356

Open Data