Table 2

Predicted miRNAs in A. auriculiformis and A. mangium.

miRNA family

mature miRNA sequence

(5'-3')

miRNA

mismatch

Length (nt)

MFE

GC %

MFEI


aau-miR319

uuggacugaagggagcucccu

3

197

-68.9

41.1

0.85

aau-miR396

uuccacagcuuucuugaacug

0

146

-63.0

44.5

0.97

aau-miR2086

gacaugaaugcagaacuggaa

0

87

-23.4

39.1

0.69

aau-miR160

uggcauacagggagccaggca

0

88

-29.4

56.8

0.59

aau-miR162

ucgauaaaccucugcauccag

0

103

-40.0

48.5

0.80

aau-miR168

auucaguugaugcaaggcgggauc

2

127

-57.8

59.1

0.77

aau-miR172

ugagaaucuugaugaugcugcau

0

165

-59.6

40.6

0.89

amg-miR319

guggacugaaggaagcucucu

0

182

-82.0

41.2

1.09

amg-miR396

uuccacagcuuucuugaacug

0

145

-63.8

44.1

1.00

amg-miR2086

gacaugaaugcagaacuggaa

0

87

-23.4

39.1

0.69


Wong et al. BMC Genomics 2011 12:342   doi:10.1186/1471-2164-12-342

Open Data