Table 3

Primers designed from Asclepias syriaca microreads hitting COSII alignments

Primer Set Name

Orientation

Primer Sequence (5'-3')

Annealing Temp. (°C)


At1g24360a

FORWARD

GCAAGATCATCAAAGGAGGCA

59.0

REVERSE

GATTTAGATCAATAACCTCCTGCCA


At1g24360b

FORWARD

GGAGGTTATTGATCTAAATCTCAC

56.3

REVERSE

AACAAGGCCAACAACTGATG


At1g24360c

FORWARD

CAATTACAGTGCTGCAAAAGCTG

60.0

REVERSE

CATATCAGATGCAATGAATCCGGG


At1g44760a

FORWARD

TACTCATGTTACTAATAAGGGTGA

-

REVERSE

CTTTGCTTTGCTTCCTCACTC


At1g55880a

FORWARD

ATGTACACAAAAGAGGAGGCTG

54.0

REVERSE

GATGCCTCATCCCACTATCAC


At1g77370a

FORWARD

CCAAAGCGCCATCTACTCCA

60.0

REVERSE

GGCCAACCAAATCCAGAAGAAT


At2g03120a

FORWARD

GAAGGTAGATCCAAATTTGAATGTC

58.0

REVERSE

GCAAGTCAACACAGCATTAAC


At2g06530a

FORWARD

GTGAAGGTAATGGCCAAAGATC

58.0

REVERSE

GTAACACCTTTCATTGCTTCTCC


At2g21960a

FORWARD

ATTGGGGTTTCTTTGTTCCATAC

53.0

REVERSE

GCAGATTGGCCAACAACTTTG


At2g21960b

FORWARD

GTTGTTGGCCAATCTGCAGA

59.0

REVERSE

TTTGTTGCTGATCTTTGCTAAGC


At2g30200a

FORWARD

ACAAGCTGTTGGAATGGGTG

55.0

REVERSE

ATCTCAACTGCAGCTAAGCTG


At2g30200b

FORWARD

ATCTATGTCACCAGCTTAGCTG

58.3

REVERSE

TTTGAATGATTTTGCCTTTGCTTC


At2g30200c

FORWARD

CAAAGGCAAAATCATTCAAAGC

56.3

REVERSE

TGCATCAACATTTGATATTACTGG


At2g34620a

FORWARD

TTCAGAAAGGTCATCAACAAATG

57.8

REVERSE

GCTGAAAGTGAACAAACCTGG


At2g34620b

FORWARD

TGCCAACATTTCTTTACAATTCAAG

52.0

REVERSE

none


At2g47390a

FORWARD

GTCTTGGTACAAAACACGCAAG

59.0

REVERSE

TCAGTTTTAGATTCTTTAGAGGTAAG


At2g47390b

FORWARD

CTAATGAGTTTGCTGGCATTGG

-

REVERSE

CACCATGTCCTTTGAGTGCG


At4g13430a

FORWARD

GAGCAAAACATAAAGTACTTCTA

48.0

REVERSE

CATTTCACCATCCATAACAA


At4g13430b

FORWARD

GTGCCTCCAACATTGAGATTTG

59.0

REVERSE

CATTCTCTAGCCAAAGCACGA


At4g13430c

FORWARD

GTGCTTTGGCTAGAGAATGCA

60.0

REVERSE

CAAGACAAGCACCACAACTAGG


At4g26750a

FORWARD

GCCTGATGACCATTTACATCTTG

-

REVERSE

TACAGGTCTCCTCCCTTCTTTC


At5g13420a

FORWARD

TGGTATGACAACCTGTGCCG

55.0

REVERSE

GTATCATCAGCAAGTCTTGGTGAA


At5g13420b

FORWARD

CTCCATGCGTCCCTTCAATC

60.5

REVERSE

TGGCACCTTTCTTCACCAGAG


At5g23540a

FORWARD

GTGTTGAAGCGGTTGATCATG

-

REVERSE

TCCATCTGTCCATTTTTTCTTATGA


At5g23540b

FORWARD

none

52.0

REVERSE

AAGGCATCAATTACCACTTTCC


At5g49970a

FORWARD

GTAGCTGCTCGTCATTTATATC

55.8

REVERSE

GAGAATCCAAACATTGCATCA


At5g49970b

FORWARD

TTGATGCAATGTTTGGATTCTC

57.8

REVERSE

GGCACACAATTTTGGAGCAG


Multiple primer sets were designed for loci where multiple read hits allowed potential amplification of different introns. Primer set names correspond to the orthologs of these genes in Arabidopsis. Listed annealing temperatures were used in amplifications of Asclepias samples. An annealing temperature of 55°C was used for all loci for amplifications of other Apocynaceae samples.

Straub et al. BMC Genomics 2011 12:211   doi:10.1186/1471-2164-12-211

Open Data