Table 2

Primers, PCR reaction conditions, and characteristics of microsatellite loci tested for amplification success in Asclepias syriaca

Primer Set Name

Orientation

Primer Sequence (5'-3')

Annealing Temp. (°C)

Repeat Motif

Product Size (bp)


As104467

FORWARD

ACTTTTTGTTCTGTTCCGAGT

52.9

TA6

100

REVERSE

CGGGGCTAGTATAGAAGAAGA


As106994

FORWARD

AGGAAGCCAATTCAAGTAAAG

48.9

GA5

129

REVERSE

GAAAATCCTTGCATGAAACT


As12122

FORWARD

TTGGTTGTTGGAACTTACACT

50.4

ATTC4

115

REVERSE

AAGCACAAGAATCAGAACAAT


As125636

FORWARD

GAACTCCTATGATCTTTCATTT

50.8

TC4...TA4*

136

REVERSE

AGACATCATGAACCCTCTTTA


As12641

FORWARD

CTCTTCATCTGGTTTCTCTTG

49.0

TA4

130

REVERSE

TGCATACAAATTTAGGTGATTC


As13110

FORWARD

AACCATAAATGCAGGTTCTTT

50.9

TA4

101

REVERSE

GCATATCTAGCTCGCATTTAG


As16135

FORWARD

TTAGGTTGTGAGAAGGGATTT

50.3

CCT4

100

REVERSE

GCTTTTATTAATGTGGGAGGA


As16369

FORWARD

AACGCTTATCCCTCACTTTAC

51.5

TA5

100

REVERSE

CCGAACTCTATATGAGTCCAAT


As196582

FORWARD

GCATTTATTGCATTGTCAAA

50.5

TGA5

113

REVERSE

GCCGTTGTTCCTCTATAATTT


As2003a

FORWARD

CCCTCGTTATTGAGAAAATAGA

50.5

ATA5

105

REVERSE

GGCTCTTACCAAAGAAAAGAT


As20679a

FORWARD

GTCATCGGAAGCTCTTTTC

52.7

CTT4

104

REVERSE

AGTCAAAAGTCACACTCATCTG


As2338

FORWARD

CATCTTGGTTAGCTCGTAAAC

51.7

TC5

104

REVERSE

CCTTACCTAGGATGAAAGGAG


As23491a

FORWARD

ATTTCCTCCATTTGTTCTTTC

50.0

TC5

101

REVERSE

GAAGTTTGTCTGAAATGGTTG


As2366

FORWARD

TTGGTGTTGTAAAGTGTTCCT

54.5

TA5

101

REVERSE

ACCAGCTCGTCAGTCAAG


As23942

FORWARD

GTGATTTCCATTTTACCATACC

51.7

AG5

100

REVERSE

ATCCTTAGCAAATAGGAGTCG


As23961

FORWARD

ACTCTTGTTATTTTGGGGAAT

49.3

TG5

108

REVERSE

CAAAAGCTTTACACGATCAAT


As282930

FORWARD

AACTTAGCTTTGGATGATGTTT

50.1

TAA4

102

REVERSE

CAATTGGGCTTGTATATCAGA


As28460

FORWARD

CACAAGATGAACATCAAAACC

49.6

AT5

100

REVERSE

TTGAGTATATTTGTTCCCCAAT


As292191

FORWARD

GGAGGGTCTAATGTCTGATGT

51.3

TG5

125

REVERSE

ATTCACACATCCCATACCAT


As43163

FORWARD

TATTCCAAGAAATTGGTCAAC

49.7

TTA4

110

REVERSE

CATGGAAGAAGAACAAAACAG


As5768

FORWARD

AAGGGAAATGATCCTTAGGTA

51.0

AG6

108

REVERSE

TTCGAAAGAGTTCCACATCTA


As71725

FORWARD

TTTACGACTCATGTACTCTTCC

50.8

AG4...TG5*

133

REVERSE

GTAATACCGGAAAATGACCTC


As77693

FORWARD

GTCAGTCAACTCAACAATGCT

51.0

TC6

102

REVERSE

TCCCAAAACTCAGATCTAACA


As81784

FORWARD

AATGTAAAGGGAGATGTTTATCA

52.0

TAT4

129

REVERSE

AGCATCAAGAACTTGAACAGA


As99212

FORWARD

TCTATGGTCAACAATTTCTGC

53.4

AT5

153

REVERSE

TTTATAGGGGTAGCGTAGGTG


*Repeat motifs are separated by 27 bp for primer set As71725 and 46 bp for primer set As125636.

Straub et al. BMC Genomics 2011 12:211   doi:10.1186/1471-2164-12-211

Open Data