Table 1

Primers used for Sanger sequence finishing of the Asclepias syriaca chloroplast genome

Region spanned

Orientation

Primer Sequence (5'-3')

Annealing Temp. (°C)


ndhC-trnV

FORWARD

GCTCGATTCGAATTGTCAAGTCATCC

57

REVERSE

AGGCCCTCCGATAGGATACTCAAA


trnQ-psbK

FORWARD

AAACCCGTTGCCTTACCACTTG

57

REVERSE

CACGGGTATGACTGGCATAACATC


rbcL-accD

FORWARD

ATCCGTGAGGCTAGCAAATGGAGT

59

REVERSE

AGGCCCTAGTCCACCAATATGGAA


accD

FORWARD

TAATAAACAATGCTAGCGATTGGG

57, 61

REVERSE

TACAATTAGATCTTAGGTCGCCAA

FORWARD

GAACCTACACGCAAGCTAGTG

FORWARD

TAAATGGCATTCCCATAGCAGT

FORWARD

TGATATCGATGCGCAAGCTAG

REVERSE

CCTATAAATGTAACTAGCACTGCA

REVERSE

GGTAGCGTATTCAATCAAACGG

REVERSE

CCAAGTATCCGGATCGATCGA


clpP

FORWARD

AATTGTATACATAATGGGCTGGT

57

REVERSE

TATTTATTCATTGCCCTGTTCGT

FORWARD

AACTACTATGATGGCTCCGTTG

FORWARD

CATAAGACCCATAATTTGATTTGAG

FORWARD

GTTTATGCTGTACTCCGGGTA

REVERSE

GGTCAATTTTATTGTAAAGCCGTAT

REVERSE

TATGCAATTTATAAAACCAGATGTCC

REVERSE

GTGAATTGAAAAAGTAGAACGTCAT


rps8 -rpl14

FORWARD

CTCAGCAATAGTGTCTCTGCCCAT

57

REVERSE

AGAGCTGTAATTGTGCGTACCCGT


ycf1-ndhF

FORWARD

TCCATCCATATCCCAATTCCATTCA

55

REVERSE

GGGCATTAGAGGATTGGCTAAAGT

FORWARD

ACGCCTCTGCATCTAGTATTG

REVERSE

GGATCTTTTGTCGAGAGCTTC


ndhG-ndhI

FORWARD

ATGCGGGCGGGTTGATATATGGTT

59

REVERSE

ATTGCTTTGGGTCGGTTACCAACGTC


rps15-ycf1

FORWARD

GGCCTAATTGATACCTCAGCGGTT

58

REVERSE

TTATCAACGATGGAACCGCCCACT

FORWARD

TATGTCTCGGTCTAGGAGAGG

REVERSE

TGTACAAGTTGATTCAGGCGA


For each region, additional primers appearing after the two original PCR primers are internal sequencing primers.

Straub et al. BMC Genomics 2011 12:211   doi:10.1186/1471-2164-12-211

Open Data