Table 4

Name of the genes, primers used and expected size of the RT-PCR products for amplification of full-length transcripts

S.No

Gene Name

Forward primer

Reverse primer

Product size (bp)


1

Acyl-CoA binding protein (ACBP)

CCCGGATACGTTCTATAAATC

CCCACACGCAAGAGAAGACACTA

524

2

Acyl carrier protein (ACP)

GAACTCTCGCTACTCTCTTTC

GCATAAATTAGGAAATTTTAGAGTGT

641

3

Biotin carboxyl carrier protein I of ACCase (BCCP I)

CGGAAATTACAAAGACAGACAC

TGTTTATAGCTTCACTAGTGTAC

1220

4

Biotin carboxyl carrier protein II of ACCase (BCCP II)

GAGGTTTATGGAGTTGTAACTG

TAATGATAAATAACAATGAAGAAGGC

1316

5

3-keto acyl ACP Reductase (KAR)

ACAGACACATTCCTTTCTTCG

CACAGTATCTGTCACCTTTTC

1417

6

Acyl ACP thioesterase (FATA)

CTGACATTGGTCTTGAGCTCC

AGTAAACGTAAAACAATACAGTTGAT

1448

7

Delta12-fatty acid desaturase (Δ-12 FAD)

ACCGAGCAGAGGCCGGTATC

CTCTGAATTTGAATTTTTATAAACC

1501

8

Acyl-CoA thioesterase (ACT)

CCGGAGCCTGGACTACTGTT

ACCCCGGCTGCTAGAATCAA

1535

10

Diacyl Glycerol kinase (DGK)

CTATCTTCTTCAATACAAGTACG

GATTTTTGATACAACAAATTACCAGT

1709

9

3-keto acyl CoA synthase (KCS)

CCGATCAATATTGAAGCAAAT

ACCAGCACAAACAATCCCAG

1715

12

ω-3-fatty acid Desaturase (ω-3-FAD)

GAAGACAATAAGCACAAATTG

CCCTCTCAAATCCAATCCAA

1741

11

Stearoyl-ACP desaturase (SAD)

CCCACTTTGATGCGTCTGCT

GACCTCCTGCTCGAGAATAGA

1769

13

Beta-keto acyl ACP synthase I (KASI)

GTAGCTCAATTTGCTGCGCCT

GCAGAAGAACACAATTTTGATAC

1908

14

Biotin carboxylase subunit of heteromeric acetyl-CoA carboxylase (BC)

ACCGCATTCAATCTTTCTCAC

GACTTCATCAACTCACTTCTA

1944

15

Pyruvate Kinase (PK)

ACCGAGGTTTCGGTCTTCACC

GACCTGCCTGCCATGGCATTC

1974

16

PHD finger family protein

ATCGTGTTCAATTTAGGATTGAG

TCTGGAGTCTTGTTCTGGGTA

4512

17

Kinase interacting family protein

GTACCTTATGTTCTGAATGATGA

TGAAGTCCTTCAAGATGACAC

5030


Natarajan and Parani BMC Genomics 2011 12:191   doi:10.1186/1471-2164-12-191

Open Data