Table 3

Sequences and GenBank accession numbers of primers used for qPCR analysis during experiment 2 and 3.

Gene

Forward 5'-3'

Reverse 5'-3'

Product size (bp)

GenBank


ANXA1

GAGGAAGTTGTTTTGGCTCTATTGA

TGGCAGCACGGAGCTCTT

67

NM_175784

CDK1

TGGACAGTCAAATTAAGAAGATGTAGCT

GTACAATTATCTGCTCTTGACACAACAC

72

NM_174016

CDK5

CCTGCTCATCAACAGGAATGG

AAA GGC GCG AGC CAAAC

61

NM_174017

CDK8

CCCAGCAGCCTCCACAGTA

TGT CCG ACG CAG CTC AGT AC

57

XM_583707

CHMP1A

CAGCCCTGGGACTCTTCTTCT

ACTCACCCTGTAGGGCACAGA

62

NM_001037584

H2AFZ

TCCGGAAAGGCCAAGACA

GAACTGCAAACCGGCTCTCT

57

NM_174809

HSPA2

AGAACCAGGTGGCCATGAAC

TCCGACCAATCAGCCTCTTG

63

NM_174344

LUM

TTCAAAGCATTCGCCAAAATG

CCGCCAATTAATGCCAAGAG

62

NM_173934

MAD2L2

GTCTACCCGGTGGGCATCT

CAT CTG GAC AGG CAC GTT GT

57

NM_001045946

MAOA

GGGCCAGATGTTCGACGTAGT

AGCTAAGAGTTTCGCAGCAGATAA

69

NM_181014

MAPK14

GCT GTC GAC CTG CTG GAG AAG ATG

TCG TCG TCA GGA TCG TGG TAC TGG

110

NM_001102

MLH1

TCCGGGAGATGCTGCATAA

CAA GGC CCA CTG AGG ATT CA

59

NM_001075994

MX1

GAGCAGTATGACTCCCGACTGTTT

TTCTCAACCACAGCACTCCATTT

71

NM_173940

NUDC

CCCCAGATCAAAGAACTGACTGA

GGC ATC CTT TTT CTG GTC AATT

72

NM_001075607

PLAU

CGCCACACACTGCTTCATTG

GCCGTGACTGACCCAAGTAGAC

68

NM_174147

PPP3CA

CCTCATCCATACTGGCTTCC

AATCCATCTTCTTCTGACCC

140

NM_174787

RBP1

TGCGCGCGCTGGAT

GCTTCAGCAAGTTGGCGATT

54

NM_001025343

SERPINE1

GGACTTCTCCAGTTTTTCAGATCAAG

CAGCGTGCCGCTCTCATT

91

NM_174137

SERPINA14

ACCCTGAGGACCTGAAACTTGAG

CGTGGACCAGAGGCTGTAAGTACT

69

NM_174797

SIPA1

GCCCATTATTCGGTGACACAGT

GAAGTCCCCTTTTCTCCACAGA

72

NM_001101895

SSSCA1

TGACTGCGGGACGATCCT

TGA CAA GCC ACG CAG TAG ATT T

60

NM_001038528

STC1

TTTGCAATGGCGGCATT

TCCCGAGGAGAGGCATAGAG

60

NM_176669

TFDP2

GGTGCCACCTTGTCCCAAT

CTA AGG CCA CTT CAG CAT CCA

64

NM_001075241

TGFB2

TCTCCAACCCAGCGCTACA

TTCACCCTCTGCTCTGGTTTTC

57

NM_001113252

TSC2

CAGAGGGCAAACAGACTGAGTTTAT

GCG ATT ATT GAG GCC ACA TTC

80

XM_581197

TXNL4B

TGGTAATCGTGATGCATGGAA

GGC TGG TTG CCT CAT GGT

58

NM_001014897


Mamo et al. BMC Genomics 2011 12:151   doi:10.1186/1471-2164-12-151

Open Data