Table 2

Let 7 family of miRNAs are secreted by hES-MSC in large numbers. This table lists common transcripts in the extracellular samples that belong to the mid-range category of between 32 to 10,000 transcripts showing a predominance of let 7 family of miRNAs. It is interesting to note that no transcripts with counts greater than 10,000 were observed in the extracellular space.

Extracellular

Transcript Number (Sample 1)

Extracellular

Transcript Number (Sample 2)

Extracellular

Transcript Number Sample 3

Transcript Sequence

miRNA Annotation


826

3653

3734

TGAGGTAGTAGATTGTATAGTT

hsa-let-7f

679

2748

1870

TGAGGTAGTAGTTTGTACAGTT

hsa-let-7g

287

69

331

AAGCTGCCAGTTGAAGAACTGT

hsa-miR-22

254

992

249

TGGAATGTAAAGAAGTATGTAT

hsa-miR-1

243

605

997

ACAGTAGTCTGCACATTGGTTA

hsa-miR-199a-3p

215

1225

931

TGAGGTAGTAGGTTGTATAGTT

hsa-let-7a

182

227

644

TAGCTTATCAGACTGATGTTGA

hsa-miR-21

170

100

515

TCAGTGCATGACAGAACTTGG

hsa-miR-152

164

389

834

TAGCACCATCTGAAATCGGTTA

hsa-miR-29a

112

42

160

TCCCTGAGACCCTAACTTGTGA

hsa-miR-125b

95

1051

149

TGAGGTAGTAGGTTGTATGGTT

hsa-let-7c

94

40

156

TGGCTCAGTTCAGCAGGAACAG

hsa-miR-24

87

159

100

AAAAGCTGGGTTGAGAGGGCGA

hsa-miR-320a

82

308

334

TGAGGTAGTAGTTTGTGCTGTT

hsa-let-7i

81

97

43

TGAGGGGCAGAGAGCGAGACTTT

hsa-miR-423-5p

71

55

310

TGGAGAGAAAGGCAGTTCCTGA

hsa-miR-185

66

46

256

AACCCGTAGATCCGAACTTGTG

hsa-miR-100

66

502

277

TGAGATGAAGCACTGTAGCTC

hsa-miR-143

39

104

87

AGAGGTAGTAGGTTGCATAGTT

hsa-let-7d

39

111

194

AGCTACATTGTCTGCTGGGTTTC

hsa-miR-221


Koh et al. BMC Genomics 2010 11(Suppl 1):S6   doi:10.1186/1471-2164-11-S1-S6

Open Data