Table 1

Let 7 family of miRNAs are expressed strongly by hES-MSC within the cells. This table lists common transcripts in the intracellular samples in the high category of more than 10,000 transcripts showing a predominance of let 7 family of miRNAs.

Intracellular Transcripts Number (Sample 2)

Intracellular Transcripts Number (Sample 1)

Transcript Sequence

miRNA Annotation


1076532

667868

TGAGGTAGTAGATTGTATAGTT

hsa-let-7f

425364

363558

TGAGGTAGTAGTTTGTACAGTT

hsa-let-7g

406433

342886

ACAGTAGTCTGCACATTGGTTA

hsa-miR-199a-3p

179887

169479

TAGCACCATCTGAAATCGGTTA

hsa-miR-29a

256612

164108

TGAGGTAGTAGGTTGTATAGTT

hsa-let-7a

162041

133623

TGAGGTAGTAGTTTGTGCTGTT

hsa-let-7i

145189

114380

TAGCTTATCAGACTGATGTTGA

hsa-miR-21

51885

49588

TCAGTGCATGACAGAACTTGG

hsa-miR-152

49042

48131

TGAGATGAAGCACTGTAGCTC

hsa-miR-143

67564

46368

AGCTACATTGTCTGCTGGGTTTC

hsa-miR-221

52911

39313

AGCAGCATTGTACAGGGCTATGA

hsa-miR-103

28369

23084

AACCCGTAGATCCGAACTTGTG

hsa-miR-100

26641

21523

TGAGGTAGTAGGTTGTATGGTT

hsa-let-7c

29311

19314

TGAGGTAGGAGGTTGTATAGTT

hsa-let-7e

15299

13189

TGGCTCAGTTCAGCAGGAACAG

hsa-miR-24

13269

10037

TCCCTGAGACCCTAACTTGTGA

hsa-miR-125b


Koh et al. BMC Genomics 2010 11(Suppl 1):S6   doi:10.1186/1471-2164-11-S1-S6

Open Data