Table 7

Primer sequences for real-time quantitative RT-PCR.

Gene

Forward Primer (5' - 3')

Reverse Primer (5' - 3')


Ccdc46

GCTGAGACCGAGATGACTCTG

GCACTTCGCACCTGATGAGA

Igfbp2

CAGACGCTACGCTGCTATCC

CCCTCAGAGTGGTCGTCATCA

Ccl3

TTCTCTGTACCATGACACTCTGC

CGTGGAATCTTCCGGCTGTAG

Ccl9

CCCTCTCCTTCCTCATTCTTACA

AGTCTTGAAAGCCCATGTGAAA

Ccl6

GCTGGCCTCATACAAGAAATGG

GCTTAGGCACCTCTGAACTCTC

Msi2

GACCTGTCGCCGATCTCTAC

GCGCTTATGTAATTCCCCACTC

Spag5

ACAGTGAGTCTGAGTTCTGCC

CTGTGAGTTTCTTGGTGAGTTCT

36B4

GAGGAATCAGATGAGGATATGGGA

AAGCAGGCTGACTTGGTTGC


Stewart et al. BMC Genomics 2010 11:713   doi:10.1186/1471-2164-11-713

Open Data