Table 1

Oligonucleotides used in this study

Name

Sequence (5' - 3')

Employment


Bxyn2p250f

Biotin-TGATGAAAGGAGAACAACTTCTAGACTG

Affinity Chromatography

Bxyn2p250r

CAGTCTAGAAGTTGTTCTCCTTTCATCA

Affinity Chromatography

CKT067

CACTCCACATGTTAAAGGCGCATTCAACCAGCTTC

EMSA/Affinity Chromatography

CKT068

GAAGCTGGTTGAATGCGCCTTTAACATGTGGAGTG

EMSA/Affinity Chromatography

Exp2488F

    GGATCC
GACCGCATGGCGCACAAC

Construction of p2488DBD

Exp2488R

    CTCGAG
TCAACAGAATCCTCTCGGGTCG

Construction of p2488DBD

Exp3151F

    GGATCC
GAAGAAACCGCCAAGGCGC

Construction of p3151DBD

Exp3151R

    CTCGAG
AGATGTGTACGTCGGGTTTTC

Construction of p3151DBD

Exp7236F

    GGATCC
ACACACGACCCCAACGCC

Construction of p7236DBD

Exp7236R

    CTCGAG
CGCGAGGGGGTTTCCATTC

Construction of p7236DBD

fltn2488f

    GGTACC
ATGGCACAAGCCCTCGACATTTCC

Construction of p2488

fltn2488r

    GCGGCCGC
TCAACAGAATCCTCTCGGGTCGAAG

Construction of p2488

LPxyn2f-FAM

FAM-TGATGAAAGGAGAACAACTTCTAGACTGGGTAAATTGGTCAATGGCCAGCCGCTC

FAM-labelled EMSA

LPxyn2r

GAGCGGCTGGCCATTGACCAATTTACCCAGTCTAGAAGTTGTTCTCCTTTCATCA

FAM-labelled EMSA

LPxyn2Mf-FAM

FAM-TGATGAAAGGAGAACAACGGAGAGACTGGGTAAATTGGTCAATGGCCAGCCGCTC

FAM-labelled EMSA

LPxyn2Mr

GAGCGGCTGGCCATTGACCAATTTACCCAGTCTCTCCGTTGTTCTCCTTTCATCA

FAM-labelled EMSA

Pxyn2af

TGATGAAAGGAGAACAACTTCTAGACTG

Radioactive EMSA

Pxyn2ar

    TGAC
CAGTCTAGAAGTTGTTCTCCTTTC

Radioactive EMSA

Pxyn2aMf

TGATGAAAGGAGAACAACGGAGAGACTG

Radioactive EMSA

Pxyn2aMr

    TGAC
CAGTCTCTCCGTTGTTCTCCTTTC

Radioactive EMSA

transkr2488f

AGCTTCCACAAACATGACGCCG

Transcript analysis

transkr2488r

CATGGCGATTTCGAGCAGTCG

Transcript analysis

transkr3500f

CTCTTCAGGTCCTTATGAAGGTCG

Transcript analysis

transkr3500r

GAGTAGCTGTCCGATCCACG

Transcript analysis

transkr3151f

GATGTCTGAGGAATCTTCAAGCGC

Transcript analysis

transkr3151r

GGAGTCTTGCTTCGATTGCGG

Transcript analysis

transkr7236f

GTGTACCTGGACCTTGCGC

Transcript analysis

transkr7236r

CTGCTTCTCCTGGGGCG

Transcript analysis


The employment of the oligonucleotides used in this study is given. Underlined bases represent introduced restriction enzyme sites or bases added for labelling. Double underlined bases indicate introduced point mutations.

Mach-Aigner et al. BMC Genomics 2010 11:644   doi:10.1186/1471-2164-11-644

Open Data