Table 1

Macrosatellite primers

Target

Application

Forward

Reverse

Size


Chr5

Probe

ACTCGTGACGAACCGACTTG

GCTTGTAGGCTTATGTCTGG

571 bp

Chr5

Probe

TGATTCCTCCAGCTGGAAAG

CAGCAAGAAGGATGGAATCC

789 bp

Chr13

Probe

GGAAATCACGGAGACCGCAG

GTTCCATTCCAATCGCCTTG

472 bp

Chr4/19

Probe

GGAGGGTGGGTTTCTTGCAG

AGACGTTGAGCCAGACTAAG

576 bp

Chr9

Probe

GGGCAAATTTCGAGTGAAGG

CCAGTTCCAGCGGTGATTTC

779 bp

Chr5

RT-PCR

CAGGGTTGTCATCCTCTGAG

CAGCAAGAAGGATGGAATCC

226 bp

Chr13

RT-PCR

GGAAATCACGGAGACCGCAG

ACAACGTGGGTGGCAGATAG

306 bp

Chr4/19

RT-PCR

GGGTGGGTTTCTTGCACGTC

CGGGGAAGTCTTCTTTGTGG

594 bp

Chr9

RT-PCR

TGGTTGACGACTCGCGAGAG

CAAAGCACCGGCCTAGATCG

154 bp

GAPDH

RT-PCR

GAAGGTGAAGGTCGGAGTC

AGGTCCACCACTGACACGTT

729 bp


Primers used in the current study to amplify the macrosatellites listed for probe generation or assessment of expression by RT-PCR analysis.

Tremblay et al. BMC Genomics 2010 11:632   doi:10.1186/1471-2164-11-632

Open Data